'There is a greater darkness than the one we fight. It is the 
darkness of the soul that has lost its way. The war we fight is not 
against powers and principalities. It is against chaos and 
despair! Greater than the death of flesh is the death of hope, the 
death of dreams. Against this peril we can never surrender. The 
future is all around us, waiting in moments of transition to be 
born in moments of revelation. No one knows the shape of that 
future or where it will take us. We know only that it is always 
born in pain."

J Michael Straczynski 

Prologue.
--------------

The showers that had been threatening that morning had now 
developed into a full scale thunderstorm, a fact that did not deter 
the two women and a man standing near an open graveside. 
The smaller of the two women clasped hold of the man's hand 
and put her head on his shoulder.  The other woman towered 
above them both, her blonde hair tied back into a ponytail and 
she was holding a large golfing style umbrella, which was doing 
it's best to keep the cortege dry.

From across the other side of the graveyard a man dressed in a 
brown raincoat looked on at the proceedings thru his miniature 
binoculars. The man brushed away a tear as he saw the other 
man slowly stoop down and place a single red rose into the 
open grave. The two women repeated the gesture and then 
drew each other into a comforting embrace. 

A cell phone inside the man's coat pocket interrupted his 
thoughts and he quickly reached inside to answer it, "Hello?"

"Friday, this is Heinlein are you ready to proceed?"

"Can I just have a few more minutes?" the man asked.

"You're needed to pick up the merchandise now."

"Ok will do, Heinlein?" 

"Yes Friday?"

"You're a bastard!" the man said bitterly and disconnected the 
call.  Placing the cell phone back in his pocket the man gave 
another sigh. 'Only fifteen more years to go', he thought. But 
then, what's fifteen years when you have at least another 
century. 

-- o -- o -- o --

Fifteen Years Later.
---------------------------

A young girl sat sobbing in her room. Her long auburn hair was 
in disarray and swept in front of her face. Still crying, the girl 
rubbed her eyes and flopped back onto the bed.

A few minutes later there was a knock at the door. "Elizabeth, 
can I come in?" a female voice asked. 

"If you have to mom," Elizabeth replied with an edge of 
sarcasm.

The door opened and in walked a woman of about forty. She 
had pale olive brown skin, deep brown eyes and her silky long 
black hair was tied back into an elegant ponytail. She was 
greeted by a cold, hard stare from the girl's blue/gray eyes. The 
ferocity of the stare sent shivers down the woman's spine, it was a stare 
that brought back so many horrific memories. Composing 
herself, she sat down by the bed and put a motherly hand on 
the girl's leg. The women then started to talk. Her voice was full 
of concern and tenderness, "Elizabeth, we thought you had the 
right to know. We were waiting for the chance to tell you. We're 
just sorry you just had to find out like this."

"When were you going to tell me? When I was about to 
get married? When I was fifty? I mean being an identical copy of 
one of the most feared women of the last century isn't 
something you happen to drop into a mother-daughter chat, is 
it!" Elizabeth gave her mother another soul piercing stare. 

"Actually we had decided that eighteen was the best age, 
sooner, if you were up to knowing. I guess fifteen isn't a bad age to
find out either. The point is, is we love you no matter who you are.
It doesn't matter to me, your dad, Auntie Cathline and to anyone
who knows you or us. The only people who would care are those
who might like to make a sensational story and some dirty money
out of it. The rest of the world has no idea who you are and
they never will, I promise."

"If I can suss it out someone else can, and then where would 
that leave me? I'd be imprisoned right away, for the good of 
society. Now I know why you make me take my medicine every 
day. I always thought it was to stop my asthma. I don't even 
have asthma so it turns out. It's not asthma medicine is it? It's 
Olanzapine. That's not an asthma medicine! It's for controlling 
schizophrenia. That's how I found out. I saw the prescription!" 
Elizabeth cried.

Elizabeth heard a set of footsteps walking towards the door. 
That'll be Dad she thought, "Come in Dad."

A tall man with blonde hair, streaked with gray strode in. "Hello 
little mite' he said softly.

"Don't you little mite me! I know what you and mom kept from 
me! I thought you loved me. I thought you cared for me! I hate 
you and if you think I'm taking any more medicine ever..." 
Elizabeth brushed her mom's hand away from her leg and rose, 
ready to storm out of the room. 

Her dad's hand reached out, grabbed her arm and gently
sat her back down on the bed again. He then sat down beside 
her and started to speak, "When we found out your mom was 
pregnant and the circumstances in which you came to be we 
had a choice."

"But she's not my real mom is she! The 'hell bitch' is isn't she?" 
Elizabeth spat the words at her father.

"She's your biological mother, true. But she died a long time 
ago. She didn't nurse you, bring you into the world, read you 
stories in the middle of the night when you got scared. Dr Bexley 
is maybe who you are genetically, but you're not her. I knew her 
even before your mother did and you are nothing like her. 
Please to God don't ever think you are capable of what she did, 
because you're not and never will be!"

"Is that why you lied to me about my asthma medicine? 

Quickly changing the subject Elizabeth's mother continued, "As I 
was saying we had a decision to make. I either carried you to 
term or had an abortion. Even though you weren't biologically 
mine I loved you as though you were and I still do. You knew 
where you came from, we told you that years ago"

Elizabeth's tone softened, "I can't call you mom can I? You told 
me I was a clone of dad, not a clone of HER. Is that why you 
had John, so that you could have a child of your own? You 
couldn't have known this from the start. Dr Bexley would never 
have told you. When did you find out?"

"I am your mom.  And as for John that's just plain stupid. We love 
both of you just the same. We found out about ten years ago. 
As you know you get record scores on your SAT's, have a 
reading age ten years above your actual one, and have an IQ of 
above 160. Dr Bexley told us that you were Dad's clone and we 
believed her. However since Dr Bexley's transformation drug left 
the brain intact and only altered the body then there was no way 
you could have gotten those scores if she was telling the truth. 
We took you in for tests and found out that our suspicions 
were correct."

Elizabeth's eyes welled up with tears once more, "That I'm the 
clone of one of the most terrifying women of the 20th century. 
Kat, why didn't you tell me earlier? Am I an exact clone? I read 
that Dr Bexley had a genetic flaw in her brain that under certain 
circumstances caused extreme psychopathic and homicidal 
tendencies. Do I have that? Is that why you gave me 
Olanzapine?"

Kat nodded, "I'm still your mom, we love you very deeply and 
just as much as we love John. Yes you do have the same flaw 
and yes that's why we give you Olanzapine, just in case."

-- o -- o -- o--

Five Years Later.
-------------------------

He was in the middle of a conversation when he saw her, such 
was the effect of her on him that he immediately forgot what he 
was talking about and watched her walk into the biological 
sciences faculty. The cut of her skirt-pants was perfect and 
allowed him to appreciate her slender and toned body as she 
passed by.

"Hey Mark, did you know your PDA's crashed?" 

"Sorry?" Mark said, his mind still on this mysterious woman he'd 
just seen.

"You were way out there guy. I mean totally Jacko'd out," Wills 
said.

Mark smiled a knowing smile back at Wills. They'd been friends 
since kindergarten. By now they each knew the others every 
whim, and foible, "I've never seen you look at a woman like that. 
Sure looks as though you've got it bad," Wills continued.

"Got what bad?" Mark answered defensively.

Wills gave a grin and shrugged, "Never mind. You better reboot 
your PDA, otherwise you'll lose the essay we were working on."

Mark flipped the small, oval shaped plastic object over and 
quickly depressed the CTRL-ALT and DELETE buttons on the 
side. He remembered his Dad telling him about the 'old days' of 
QWERTY keyboards, mice and such like paraphernalia. 
Standards died hard though and now the only remains of the 
'old days were these three discrete red buttons. A few seconds 
later and the Sony-Micro-Sun-Paq logo appeared on the screen 
and the PDA was ready for work again.

"Better check that essay," Wills stated.

"Who was that?" Mark asked, still distracted by the memory of 
the girl.

"Mark?" Wills queried.

"Sorry," Mark said and spoke to his PDA

"PDA, verify contents of memory"

After a few seconds A dulcet female voice replied, "Everything's 
intact Mark. Do you want to backup your data?"

"PDA, Sure, how long till my next lecture?"

The PDA's voice replied, "Mark, your next lecture is in 10 
minutes. From your current location it will take you 15 minutes to 
get there. Do you want to mail the lecturer stating a reason for 
your lateness?"

"Shit!" Marked exclaimed and then added, "PDA Don't bother, I'll 
make it."

"See ya after hours?" Wills asked.

"Same place same time," Mark had time to call as he began to 
sprint to his next lecture.

-- o -- o -- o --

The woman who had been Mark's focus of attention sat down at 
large, fake mahogany desk. Hunting around in her purse, she 
pulled out a sleeker, more expensive looking version of Mark's 
PDA and switched it on.

A female voice, a smooth as a nightingale's song spoke out 
from the PDA, "Good afternoon Anne, What can I do for you?"
 

"PDA, download the contents of the United Nations Marine 
Biology reports on the Coral reefs around the Maldives for the 
years 1995 until current day. Also give me status reports on the 
revised Human Genome projects, post Fury Directive til current 
day."

Anne paused, waiting for the PDA to catch up. Although 
equipped with a terabyte molecular storage datacard it still took 
a few seconds to store information. A few seconds later the PDA 
replied, "Done."

"Ok. PDA, show me the status of my bank account, screen only, 
apply private code 249 modulus 69. Password is, " Anne 
paused for a few moments before typing the word 'Phoenix' into 
the PDA's virtual keyboard.

The PDA flashed a large seven figure sum on screen. Anne 
nodded in approval and then added, "PDA, show bank account 
status private code 148 modulus 63. Password is," Anne typed 
in the word 'daughter' 

"Anne, your current bank account is one hundred and three 
dollars and twenty four cents," The PDA replied.

"Thank's. PDA display contents of the reports you just 
downloaded."

Anne sat back on her chair and started to read.

-- o -- o -- o -- 

Mark's tutorial dragged on forever; his mind was still on the girl 
he'd just seen walk into the faculty building. Even though his 
grades were borderline at best and this close to the end of his 
Ph.D. he needed spectacular grades in order to even scrape a 
pass. However, at this point in time none of this bothered him. 
The girl going into the faculty building was all that mattered.  
Mark day dreamed about the girl, how her hair fell in perfect 
formation onto her shoulders, how her shape was contoured by 
her skirt-pants. In his mind the girl performed a delicate pirouette, 
showing every inch of her perfect form. He could imagine 
running his fingers thru her blonde hair, the smell of her perfume 
and most pleasing of all the sound of her voice. It was like music 
from the gods.  If Helen of Troy could speak it would be like this. 
His mind moved deeper into his fantasy. She would, he decided 
be like an iron fist in an ever so soft velvet glove. She would be 
feminine, with all the little girl vulnerabilities  but have a steel 
backbone. She would be like the willow delicate, supple but 
unbreakable in the strongest wind.  She would be his shelter in 
the storm and he, like the oak would be hers.

Still in his dream world Mark tried out various conversations with 
her, examining each permutation in meticulous detail. They 
ranged from a simple 'hi' in a corridor to flowers to her dorm, 
with him dressed as a delivery clown.  The way to her heart, he 
decided was to make her laugh, because her laugh would 
ensnare his heart and never let go.

The sound of chairs being moved backwards woke him from his 
daydream, the tutorial was over already and he hadn't listened 
to a word! Hopefully his PDA had got enough storage space to 
record it and he could get the gist of it. Quickly packing up his 
stuff and after making a quick excuse to Wills he sprinted off to 
the library. She should still be there, she had to!

Breathless he bolted into the library, much to the disdain of the 
librarian and looked around. She was nowhere to be seen. He 
tried to look interested in the rows of books as if searching for a 
vital fragment of information but in reality he was scanning the 
mostly empty tables for a glimpse of her. A few minutes later, 
his hopes shattered and his heart in pieces he walked out of the 
library. She was gone!

Mark tried his best to hide his disappointment at not seeing the 
girl again. His pride wouldn't let him play the lovesick teenager 
and go to the girls dorm and ask about her but try as he might 
he couldn't get the girl out of his mind. He thought about going 
back into the library to ask around but he'd promised Wills he'd 
go and check out the latest Kweepa and Rooney movie and 
besides, he was due to go on a field trip to Egypt for a couple of 
weeks tomorrow. Still, he thought there was plenty of semester 
left to find her and it'd wait until he got back.

-- o -- o -- o -- 

"Here take a flyer miss," a well groomed young man pointed his 
PDA at the object of Mark's daydreams. There was a small beep 
and the man moved onto his next target.

The woman wished that somebody would invent an advertising 
bypass function in a PDA but even her top of the range model 
wasn't immune to online adverts and generally annoying 
commercials. Reluctantly she looked down at the flyer that had 
been placed in her PDA. The sight of it made her sick, she 
hated cults. Especially this one, this one gave her the creeps and 
chilled her to the bone.

The flyer said "

        o She was the most misunderstood woman of the 20th
          century. 
        o Her self sacrifice and compassion is a lesson to us
          all.
        o She gave up her one true love to show us how to love.
        o Her life was a lesson on how to forgive and obtain 
          forgiveness. 
        o Do you want to learn to love? Do you want to learn to
          forgive? Do you need forgiveness and inner peace?

        If the answer is yes please call 'The Children of Bexley'
        One person CAN make a difference.
        http://www.come.to/children-of-bexley" 

If she could have she would have torn the flyer up and thrown it 
to the four winds but instead she deleted from her PDA, gave a 
deep sad sigh and walked back to her dorm. 

Sinking down onto her bed she thought back to the flyer. Seeing 
it upset her more than she let on.  Why did these people insist 
on latching onto a woman who had been dead nearly thirty 
years? Why couldn't they find another 20th century woman to 
latch onto, Mother Theresa, Princess Diana, Anne Frank, just 
anyone but Dr Elizabeth Bexley. Part of her wanted to attend 
one of their meetings, to prove them wrong, to correct the error 
of their ways, but deep down she knew it would be a futile 
gesture. Anyway she had larger things to attend to, like her 
upcoming move to England. Things were nearly ready and the 
timetable had just been finalized. She would spend the first two 
years of her doctorate in England and finish her final year 
back in the USA. With no family ties, such a move was a no-
brainer.  Wearily she picked up her PDA and started to read.
'The last thirty years has seen a dramatic reduction in the coral 
surrounding the Maldives. It was determined back in the 1970's 
that coral is the indicator to the ecological health of the Ocean.  
Such a decline can only mean that the environmental death of 
the Indian Ocean is less than sixty years away. This paper will 
outline the rationale behind this statement'.

Unable to concentrate further she put the PDA down on the bed, 
closed her eyes and dreamt of happier days to come. The trip to 
England was two days away and she still had a lot to do. 

-- o -- o -- o --

"And this will be your room, Miss Stephens," A small matronly 
woman opened a large wooden door and gestured inside. 

Elizabeth walked into the room called ,"lights," and was a little 
surprised that the lights didn't slowly come on.

"Oh didn't I mention, we don't have voice activated appliances 
here. Here just use the switch," the women gestured to a small 
switch on the wall and as if to demonstrate her point flicked it 
on.

"Switch? How quaint," Elizabeth said under her breath. The 
room was how she expected a dorm at Cambridge to be. All old 
world, dark wood and musty. Bookcases lined the wall, an old 
fireplace with a sooty white marble hearth was against one wall. 
The doors leading into the other rooms had a used look about 
them and the green carpet had seen better days. The only clue 
that this was now the 21st century was a Sony-Nintendo picture 
screen on the far wall, apart from that the date could have been 
anytime  from the last two hundred years. 

"If you follow me I'll show you to your room," the woman said, 
pointing to one of the doors.

"This has got two bedrooms?" Elizabeth queried.

"Didn't your mother mention, you're going to have a roommate."

Elizabeth frowned, the last thing she needed was some prissy 
English girl getting in the way. Still at least she was here, on her 
own and about to embark on her greatest challenge to date. 
Elizabeth said none of this, only "No she didn't but I'm sure it'll 
be fine. Do you know her name?"

The woman gave a shrug, "No, All I know is that she's from 
London."

"Which London, old or new?" Elizabeth queried.

"New I think. It's all the same place to me dear."

Elizabeth was already getting bored with inane British 
conversation and decided to make her excuses. "If you don't 
mind I've had a long trip and could really do with a shower and 
some time to unpack. Do I need to sign in or anything?" 

"No that's fine. I hope you've brought some warm clothes with 
you, it talks about being chilly tonight," the woman said, not 
really getting the message.

"I'll be fine," Elizabeth replied.

"I hope so. This is nothing like living on that Island of yours is it? 
Mind you, I do feel jealous of you, y'know. With your parents 
being so famous n all. I wanted to be famous, did I ever tell 
you..." 

Elizabeth desperately wanted to stop the conversation and 
imagined reaching down the woman's throat and ripping her 
tongue out. Instead, she smiled sweetly and replied, "I'm sorry I 
really am very tired. I'm sure we'll get chance to talk some 
more."

"Oh that would be nice, I always cook scones on Friday and 
you're welcome to join me."

Elizabeth nodded and wondered what ripping out someone's 
tongue would feel like , "That'd be nice. Goodbye."

"Cheerio, nice to meet you, " the woman said, and closed the 
door behind her.

Taking a deep breath Elizabeth walked into her room and in 
spite of herself flopped down onto the bed and fell asleep. 

Elizabeth was awakened an indeterminate time later by 
someone hammering on the door. Groggily she stretched out, 
swung her legs off the bed and walked towards the door. 
It wasn't until she had got closer she heard a male voice call out
"Hey Kiddo, I know you're in there. What's up sleepy head,
the English weather got you down already?"
The voice was followed by another staccato series of loud 
bangs.

Elizabeth groaned inwardly, but decided to leave the comment 
for when she opened the door. She wondered what kind of face 
would best suit the moment and decided nonchalant disdain 
would send the right kind of message. With all necessary 
measures in place she opened the door.

Standing in front of her was a tall, olive skinned man with deep 
brown eyes, raven black hair, and a confident looking grin on his 
face. He was wearing the latest Beckham-Kline shirt with its 
wide collar and triple breasted pockets and she noted the now 
traditional Neo-UV sunglasses poking out of one of the pockets.

"Hi Kiddo. Pleased to see me?" the man's rich, deep voice 
asked. After the question the man's eyes gave a mischievous 
twinkle and he broke out into a broad disarming smile. The 
bright white teeth showing in start contrast to the dark olive skin.

Elizabeth couldn't help but smile. He ALWAYS did that to her. 
She'd get all wound up, ready to unleash some devastating put 
down; but when she tried to launch it, it just died somehow. All 
she could manage to say was "Oh Hi it's you. You on your 
own?"

The man gave another knowing smile. "Who else calls you 
kiddo? Mom's here as well, she just parking the car."

Elizabeth tried her best to emulate the disarming smile, but she 
knew she couldn't really pull it off. "And you can cut the kiddo 
crap out as well. You're only four months older than me anyhow. 
You'd better come in. I've not had chance to unpack yet so I 
can't offer you much in the way of a drink."

"So'k we were well fed on the starplane."

"You got to go on one of those? I thought there wasn't a regular 
service yet?" Elizabeth stated. The boredom and stress of a 
nine hour flight from New York hadn't yet subsided. 

"Mom pulled a few strings. It was out of this world. You take off 
from JFK like a normal jet, climb to 50,000 feet and then WHAM 
the ramjet kicks in until you're nearly in low orbit. You get 
another WHAM when the rocket part of the engine kicks in and 
presto New York to London in under an hour. They say it'll do 
NY to Sydney in under two. A-F-ing-mazing. Brits invented the 
thing too, years ago just nobody wanted to put money into it."

"You make me sick. You always manage to go one better don't 
you." Elizabeth said jokingly.

"Hey that's what I'm here for."

"AND it helps that your mom is Rachel Martin doesn't it?"

"That too. Hey I'm really tired after my 50 minute flight.  Can I sit 
down?" the man asked, and gave a long false yawn.

"Sure, you can see where the sofa is", Elizabeth replied, not 
rising to the bait.

"Was someone just talking about me?" A voice called out from 
behind the doorway.

Elizabeth gave a squeal of delight and ran to hug the figure now 
standing at the door, "Auntie Cathline! Hi"

Cathline responded to the hug, "Hi Lizzy, long time no see."

"You betcha. You look great! Come in."  

Cathline gave a smile, "Thanks I always look great." 

This was a running family 'in joke'. Now nearly fifty, Cathline could 
still pass for less than thirty. When people asked her how she 
did it she'd always reply with the comment "it's in the genes". 
Cathline Richards alias Rachel Martin could still stun a room of 
people with her grace and beauty. 

Still grinning from ear to ear, Elizabeth beckoned Cathline to sit 
down next to her son. Elizabeth sat down on the opposite 
armchair. "Is mom and dad coming over?" Elizabeth asked 
expectantly.

Cathline's perfect face dropped a little, "They couldn't make it 
this week.  Senator Jameson's asked them to help out with his 
presidential campaign so they're all caught up in that. Kat, sorry. 
Your mom asked if I wanted to run for Congress as well but I'm 
not into that kinda thing."

The man sitting next to Cathline patted her leg in mock comfort, 
"Ahhh  how sad, you'll just have to put up with being a roving UN  
Ambassador won't you."

"So that's how you pulled off the Starplane flight?" Elizabeth 
stated. "That's an abuse of privilege isn't it?" Her quip hid over 
the fact that she was bitterly disappointed that  her parents 
hadn't turned up to see her settle in, typical! At least Cathline 
was here. 

Cathline gave another devastating smile, "Hey not my idea.  It 
was Alex's. It's not my fault he talked me into it."

Alex gave an incredulous look "No Mom it wasn't was it?"

Elizabeth relaxed a little. Being with Cathline always had that 
effect on her. Her son, Alex however had the opposite effect. 
Somehow he knew what buttons to press to make her feel off 
balance and awkward. It was a knack that usually only big brothers 
have, but he seemed to have acquired it anyhow somewhere down the 
line too. Elizabeth was saddened to hear that her mom and dad 
couldn't make the trip and on that thought said, "I'd have thought 
mom and dad could put aside just one trip to see me settle in."

Cathline gave a comforting smile, "They do love you Y'know. 
When they said that they couldn't come I thought the same thing 
as you. Kat as always knew what I was thinking and explained 
that they trust you to do the right thing and that you have it all in 
hand. Of course they'll visit next week just to be sure, but I 
wouldn't worry about them not loving you. Kat cried herself to 
sleep at the thought of her little girl moving away for so long. 
They will miss you. Alex dear go and swipe the meter for me, 
I'm not sure how much time I put on it."

"OK mom," Alex said, and left the room.

"Good! Now he's gone for a while, so I can say what I really want to 
say." Cathline said in a secretive way.

"Which is?" Elizabeth offered.

"I hate keeping the truth about you from Alex, but it's the best 
way. As far as he knows you're Kat's daughter not Dr Elizabeth 
Bexley's. Some things are best left unsaid. Anyway the real 
reason why they're not here is that they wanted you to stand up 
on your own for a while. Sure they'll be there to catch you if and 
when you fall, but they don't want to repeat the mistakes Dr 
Bexley's parents made of wrapping her up in cotton wool."

"I know. We decided a few years ago that if we couldn't change 
the genetic factors we can change the environment. I'm glad 
you're here Cathline. I need someone to talk to."

Cathline placed her hand on Elizabeth's arm, "I know that's why 
I came."

Elizabeth suddenly had a revelation but only raised a quizzical 
eyebrow in response, "It's odd. I know, sorry I can feel why 
you're doing what you're doing. You're playing the 
counterbalance role aren't you. You're the soft edge to mom and 
dad's hard one aren't you? They've asked you to look after me 
in ways that they won't allow themselves to. You're my safety 
net. My judge and jury. What happens if I start acting like HER?"

Cathline was inwardly shocked at Elizabeth's insight. She 
scrabbled around for an answer and tried to think of a way of 
averting more questions. Elizabeth would be able to spot a lie 
instantly. Cathline nodded slowly and answered, "You're your 
mother's daughter alright."

Elizabeth raised her voice a little, "Which Mother? Kat or my real 
one?"

Cathline gave a smile, "That, kiddo, is entirely up to you."

Elizabeth was still rattled by her revelation. So much of her 
childhood slotted into place now. Why hadn't she seen it earlier?
"It fits It all fits. The three of you, mom, dad and you decided as 
soon as you knew about me how you were going to raise me 
and what you were going to do in the event of me turning out 
like the hell bitch."

Cathline could sense the anger starting to brew inside Elizabeth. 
She needed to defuse it and fast, "You are quite correct. But I 
don't see how it's any different from any other parenting. With 
Alex I had a plan how I was going to raise him before he was 
even born. I knew what I was going to say and do in certain 
situations before they came up. Any good parent knows how 
they want to bring up a child before they have one. Sure they 
can change plan or tack as things evolve. Listen, who you are 
has made no difference to the approach we used to bring 
you up. I'm your God Mother right?"

Cathline's logic was starting to defuse Elizabeth's anger. 
Elizabeth just nodded in response.

"Well, I take that role seriously. It's my responsibility as your 
God Mother to ensure that you are being brought up in the 
correct way. It's the same for John as it is for you. If I'm acting 
as the counter balance as you call it, it's because we think a 
counter balance is needed, not because your mother was Dr 
Bexley. That's an important difference."

Cathline was right of course, "I hate it when you three gang up 
on me," Elizabeth replied.

Now in full flow Cathline continued, "It's not us versus you. It's 
not you versus anybody. It's how Kat and Matthew decided 
to bring you up. I knew Elizabeth Bexley when she was a little older 
than you and you are nothing like her. From where I'm sitting 
Kat and Matthew have done a wonderful job of raising you. 
You're a brilliant, witty and sensitive young woman. You're more 
like Kat than HER and I should know. Listen, how many times 
must you be told before you believe us. You are nothing like 
your biological mother and never will be!"

"Then why all the subterfuge? Why make me take Olanzapine 
until I was old enough to decide for myself?"

That was a question Cathline refused to answer.

Elizabeth however refused to let it drop. "I thought as much. You 
DO think I'll turn out like HER."

Cathline made eye contact with Elizabeth and said, "No we 
don't!  Out of all the time you spent with Matthew and Kat did 
you ever think for one second that they didn't love you?"

Elizabeth knew that Cathline was right, "No," she shook her 
head gently.

Cathline continued, "That's a thought worth holding onto don't 
you think? Look this is something you need to talk to Kat or 
Matthew about.  This goes beyond my...."

"Beyond What Mom?" Alex called out as he entered the room.

Cathline jumped ,"Alex, don't do that to me. How long have you 
been lurking?"

Alex shrugged "I don't lurk. The Meter was all paid up anyway. 
When do we eat?"

Cathline turned to Alex and said, "We don't. We've got to leave 
now. We're taking a normal flight back, and I've got some 
business to attend to in New London. Elizabeth, remember what 
I said to you earlier. I'm sure you'll settle in just fine."

"But mom, we just got here," Alex complained.

"I know you want to wind up Elizabeth some more, but I think 
she's got enough to do. Elizabeth, nice to see you again. Say 
bye Alex."

Alex replied with a grin, "Bye Alex"

Elizabeth stood up and gave Cathline a hug, "Thanks Auntie 
Cathline. Tell mom and dad they were right won't you?"

"Sure," Cathline said and returned Elizabeth's embrace. She 
was relieved she'd managed to avoid a fight with her. Kat was 
right. Elizabeth needed to be handled the way they'd planned it. 
It was the only way.

-- o -- o -- o--

Angela Holden struggled with her bags as she strove to get to 
her new room. The cab driver had dropped her off nearly a 
kilometer too short and now as she clutched all her worldly 
goods she really wished she had some knight in shining armor 
to help her carry it all.

She could just see her destination when she saw a very tall, 
stunningly beautiful woman walk out of there, followed by a tall 
athletic young man. The man casually looked around him, 
apparently taking in the serene, scholarly and timeless 
atmosphere that Cambridge still generated after all these 
centuries. Angela's heart skipped a beat as she saw him look at 
her struggling with her bags. He tapped the tall woman on the 
shoulder and whispered something to her. The woman turned 
and her single good eye looked right at Angela and she nodded 
her approval to the man. Angela eyes widened, Rachel Martin!  
Before she could think any further she saw that the young man 
was running towards her. 

"Hi, I noticed you were having trouble with your bags? Mind if I 
help?" the young man asked Angela.

Angela, now fully composed, took the opportunity to study her 
potential rescuer. She would later describe him as tall, dark and 
handsome . Gallant too if his offer for help was for real. Before 
she could say anything he followed on, "I'm sorry my name is 
Alex Richards and you are..."

"Angela Holden, " Angela blurted out. This is Rachel Martin's 
son!!!

"Well Angela Holden, you have two choices. You can let me 
carry your bags where you want to go, as long as it's not Oxford 
or anything, or you can struggle with them yourself? "

"I'm sorry I wasn't expecting..." Angela blurted out. She'd seen 
Alex's face in several magazines, but to meet him face to face 
had taken her breath away. In her teenage years she'd had a 
crush on him, and now to finally meet him was too much.

Alex gave another wide smile, "It's ok, I have this effect on 
women all the time. Here let me take that for you," Alex offered 
to take the largest two bags from Angela. 

Much relieved Angela let the bags go and instantly felt better. 
Her shoulders felt raw from the straps digging into them and to 
have any kind of relief was a godsend. "My room's 22B, " she 
managed to say. She noted a 'Oh no' kind of look flick across 
Alex's face, but it was gone before she could be sure 
what it really meant.

Alex hoisted the large bags onto his shoulders with an ease that 
surprised Angela and started off towards the direction he had 
come from. Angela went to show Alex where her room was, but 
Alex seemed to already know. "It's just on the right," Angela 
said.

Alex nodded and put the bags down onto the floor and knocked 
loudly. 

"Ok, Ok," A voice called out from the room and Angela heard 
the sound of a key being turned in the lock. Angela then had her 
second shock of the day. Standing in front of her was none 
other than Elizabeth Stephens. Her hair was a little untidy and it 
looked as though she had just woken up.  That face with it's 
tumbling mass of auburn hair and blue-gray eyes was 
unmistakable. 

Alex broke the silence "Before you say anything Kiddo, I'm here 
helping your new roomie with her bags."

Angela saw those blue-gray eyes flick a curious look in her 
direction as if saying 'I'm not sure about this,' but then the mouth 
broke into a wide smile, "Hi I'm.."

"Elizabeth Stephens," Angela completed in a hushed overawed 
tone.

"No hiding from this face is there?" Elizabeth grinned. "I'll take 
your bags for you. Alex, in the best possible way, get lost! 
Auntie Cathline is waiting for you"

"Okay, okay, I know when I'm not wanted," Alex tutted in such a 
way that Angela knew she wasn't that upset about being 
given his marching orders. Alex turned to Angela and said 
"Angela it's been a pleasure meeting you. I don't envy you 
having her for a roommate. If you ask me they should never 
have let her out." With that last comment Alex gave a single 
fingered salute and turned to leave.

Angela turned round and gave an appreciative glance at Alex's 
ass, "Very nice," she commented.

"So'k, you can have him," Elizabeth retorted. "Now let me show 
you around."

-- o --o -- o--

Anne Baxter sat on the plane staring out into a bright blue sky. 
The view from an aircraft never ceased to amaze and stun her. 
She loved to lose herself in the endless variations of cloud, land 
and sky. To her, flying was the second most enjoyable way to 
travel. By far and away she preferred diving. She had first done 
it years ago and had never forgotten the feeling of absolute 
freedom and oneness with nature. It was this feeling that had 
driven her to study marine zoology and biology. Her career in 
medicine had been cut short by the love of the ocean and it was 
one she never intended to follow up again.

She had enjoyed her time at Haverford, but now it was time to 
move on. Since the death of her parents when she was younger 
she had, had no real home, and no roots to put down, and that, 
she decided, was just the way she liked it. 

Her transfer to England had fallen thru at the last moment, 
something to do with her visa she was told, but she had been 
given an alternative placement in Tel-Aviv for six months before 
having to return to Haverford. Looking on the bright side Tel-
Aviv was a whole lot warmer than Portsmouth and the Red Sea 
was more inviting than either the North Atlantic or Anglo-French 
Channel. 

Tel-Aviv had been repopulated for over ten years, the deadly 
agent spread by the Guild had been neutralized, the remains of 
the people cleared away, and much of the infrastructure rebuilt. 
Tel-Aviv was now one of the most modern cities in the world, the 
chance to improve had not been missed but still, so it was said, 
the aura of death hung over the city. Elizabeth had used her 
PDA to brush up on the new Amex-Rough guide entries on it, 
and the thought of living in a place where over half a million 
people had been slaughtered was enough to make her stomach 
churn. How could she walk down those streets knowing that in 
every house and every office block people's lives had been 
snuffed out?

She shut out anymore thoughts and reflected back on what she 
really wanted to do. Go diving, study marine life, and finish her 
dissertation.

The plane was starting it's descent and she would be in Tel-Aviv 
in just over twenty minutes.

-- o -- o -- o--

"Ok then, Heels or flats?" Angela grinned.

"Flats, anytime," Elizabeth replied. 

"Same here. We're about the same height and heels make me 
look far too tall," Angela retorted. They'd been playing the 
'answer right away' game for a while now.

"My turn. Skirt Pants or Skirts, " Elizabeth asked, casting a quick 
glance to the black Skirt-Pant she was wearing.

"It's pretty obvious what you prefer, "Angela grinned.

"It might not be. I might hate this, but it's the only thing that was 
clean. Anyway you're supposed to answer without thinking. That 
is the purpose of the game is it not?"

"Ok then, Call me old fashioned, skirt."
 

"My turn again, Beckham-Kline or Armani?," Elizabeth queried. 

"Oh yes old bean, Beckham-Kline! I never buy less than five at a 
time," Angela joked, putting on a false English upper class 
accent.

Elizabeth felt embarrassed. Much to her amazement she was 
getting on extremely well with Angela, and had forgotten that not 
everyone could afford the designer outfits she wore. "I'm sorry. I 
didn't think," she muttered.

"It doesn't matter. My Mum and Dad had to save for fifteen 
years to send me here, and the fact that I'm -- how'd you call it --
roomies with the famous Elizabeth Stephens, and at the best 
university in the world is more than enough," Angela said, piling 
on Elizabeth's guilt.

"This is a stupid game," Elizabeth commented.

"Ok my turn then. Money or power?" Angela asked.

"Power, anytime."

"Money," Angela smiled back.

"Can I ask you a favor?" Elizabeth asked.

"Depends. We've only known each other an hour," Angela 
retorted.

"Forget who I am."

"Huh?"

"You've mentioned me three times as though I'm some 
superstar. I came here to be me. Not some media image, or 
some fixation of that perverse Bexley cult, but to discover who I 
am and where I fit in.  Please let me be just plain ol Elizabeth 
Cathline Stephens."

Angela ought to have been upset, but Elizabeth had been right, 
she had been looking at her as though she was some royal 
princess. "Ok, Lizzy. I'm sorry, it's just that I've never even seen 
anyone remotely famous let alone live with them. My Dad used 
to be a computer programmer, before it all became automated 
and he was laid off. And Mom worked as a secretary for Sony-
Micro-Sun-Paq. We never even went on holiday, sorry "vacation," 
as they put every Euro they had into giving me a better chance 
than they had."

"It must have been hard. They must really love you," Elizabeth 
said softly.

Angela thought she detected a note of jealousy in Elizabeth's 
voice, "I just hope I live up to their expectations."

"I'm sure you will. If you put your mind to it you can do anything. 
It's not been a picnic for me either. Yes Mom and Dad never 
had to save to get me anything but I've always been in the 
public eye. I've had more DNA tests than I can remember, 
psychological screenings, IQ tests. And those photo's on the 
front of the Enquirer last year were the worst ever. I have had no 
privacy, and when people look at me they don't think oh look 
that's Elizabeth Stephens they see HER, Dr Elizabeth Anne 
Bexley. That horrid Bexley cult is the worst of the lot. Until tests 
proved otherwise they thought I was the Second Coming or 
something. That's the hardest thing of all. I can cope with blurry 
topless photo's of me on my mom and dad's island but any 
reference to the hell bitch just gets me right here, " Elizabeth 
pointed to her heart.

"I'm sorry. Look if it's any help I don't believe any of those 
rumors. I was just a little star struck that's all," Angela said, now 
it was her turn to feel guilty.

"Hey I'm star struck too. It's not everyday I get to share a room 
with Dr Angela Holden the greatest neurologist the world has 
ever seen," Elizabeth grinned. The tension had been broken 
and each of them had shown an exposed side of them. The 
bond of acquaintance had grown into the glimmer of trust.

-- o -- o -- o--

Wills caught up with Mark in the canteen. He'd been worried 
about him for a few days. Mark had been sullen, almost silent, 
and to make matters worse had skipped several tutorials. At this 
rate Mark was on collision course to fail his doctorate. Wills had 
tried to talk to him several times but each and every time he had 
gotten the cold shoulder treatment. It didn't take the length of 
time they had been friends to work out that something was very 
wrong with the normally upbeat Mark. 

"Hey bud," Wills said cheerfully.

"Huh," Mark replied in a sullen tone.

Wills gave Mark an ultimatum "Ok. Look, you can ignore me or 
grouch at me all you like but I'm not going away 'til you talk to 
me."

"Ok fine, but there's no point. You can't help me, you'll just have 
to put up with me," Mark replied.

"Since when have I ever put up with you?" Will asked with a 
comforting smile on his face,

Mark managed a shrug back "Since now."

Wills indicated to Mark that they should take a seat at an empty 
table at the far end of the canteen. Mark grudgingly agreed and 
sat down opposite Wills.

Mark, admitting defeat and feeling as though he had to tell 
someone, fiddled with his chicken salad for a while before giving 
Wills a lost puppy dog look. "I went to find her."

"Who?" Wills asked.

"The woman I saw going into the faculty the other week."

"You never told me?" Wills asked.

"As soon as I saw her I couldn't get her out of my mind. 
Something just clicked inside me and I knew that she was the 
one."

"How can you know that? Anyway let me guess, she blew you 
out," Wills said. He was tempted to make some kind of quip but 
by the look on Mark's face this was no joking matter.

"Worse. Her neighbor told me that she's gone to Tel-Aviv. Now 
I'll never see her again. If she'd blown me out as least I'd have 
known where I stood, but now I'll never know. I was so sure she 
was the one. Now I can't concentrate on anything and my 
grades are slipping. That makes me more depressed and 
makes me think more about losing her. I'm in a vicious circle," 
Mark now looked thoroughly down.

Wills, all thoughts of quips now quashed, said, "Did you get a 
name. She can't have gone to Tel-Aviv forever, she has to come 
back here to finish her course."

"I thought of that but her neighbor told me she was going to 
England for two years but that got cancelled and so she went to 
Tel-Aviv instead. Two Years, that's a long time. She'd find 
someone else in that time. I may as well face it, I blew it, the one 
woman I ever wanted and I've blown it." 

Wills had an idea. "Look what's her name, we can look her up on 
the net's white pages. Find out all about her and then we'll know 
more. As for your grades, if you're not here in two years how can 
you meet her when she gets back?"

Mark gave a smile. Hope had been restored and Wills was right. He 
would work harder now. He had to be here when she came 
back. "Her neighbor gave me her name, Anne Baxter."

-- o -- o -- o--
  

Anne eventually emerged from the Tel Aviv arrivals lounge and 
was hit by the dry heat of the midday sun. After waiting in line 
for her baggage she headed for the local Avis rental desk. It 
was a fair drive to her lodgings and already she was tired from 
the long flight over. After queuing for about ten minutes she 
reached the desk.

"Passport please," the Avis lady asked.

Anne noted how all service desk, Hostesses and receptionists 
all seemed to look the same the world over. Maybe it was their 
impossibly sunny disposition that caused made her think that. 
Anyway she handed over her passport to the lady.

The lady studied it for a few moments before returning it, 
"Driving permits please."

"Will this work? It's got all the options I want?" Elizabeth fished 
out her PDA and showed it to the lady.

"Sure, just aim it at the terminal, its called Avis4526" 

Anne was relieved, the last thing she wanted to do was fill out 
masses of forms. She pointed the PDA at the lady's terminal, 
"PDA, transmit my driving permit and hirecar details to terminal 
Avis4526."

The lady gave a smile, "Thank you Ms Baxter. You car is in lot 
24. It's the blue GMFord starlight. It's been serviced last week 
and there's a spare fuel cell in the trunk if you need it. I've 
transmitted your biometric profile to the car so all you need to do 
is grab the handle. I've also sent an online map of how to get to 
the car so just consult your PDA. Enjoy you stay, thank you for 
using Avis."

Anne gave a nod of thanks and wheeled her luggage cart 
outside into the blazing heat of the day. On her way out she 
noted the small plaque on the wall commemorating the twenty 
three thousand men, women and children that had died at this 
airport over twenty years ago. Anne had seen this in the 
guidebook. In every building and street there were memorials to 
the dead, but seeing it here on a wall really brought home the 
atrocity that had been committed in this now thriving city. She 
hoped she would be able to remove the morbidity of this place 
from her mind but then again did she want to? Would doing that 
deprive her of her compassion? Only time would tell.

Anne consulted her PDA and a flashing arrow told her that the 
Avis depot was two hundred meters to the left. A few minutes 
later she was standing next to a Blue Gmford. It had been newly 
washed and sat there gleaming in the sunlight. Anne grabbed 
the handle of the car and the door sprung open. Miniature 
sensors on the car handle had read her hand and fingerprints. 
Cross checked them with its database and had decided that she 
was who said she said she was. Anne reached inside the car 
and pressed the trunk release and moved around to the rear of 
the car and loaded her luggage into the trunk. After dutifully 
sliding the cart back into the cart retrieval area she got inside 
the car and closed the door.

Within a few seconds the cars climate control had kicked in 
filling the car with warm, cool air. Anne had one last thing to do 
before she was ready to leave, she pointed her PDA at the car 
entertainment system. "PDA, download all music tracks to 
Gmford regno A56433X. Also program GeoNav system with our 
destination and work out the quickest route avoiding all current 
congestion," the PDA confirmed its acknowledgement.

Anne felt her seat reshape it's self to give a perfect fit, and after 
settling herself down. She pressed the start button on the 
console and felt the smooth hum of the engine. "Car engage 
autoNav and let me know when we're five minutes away.

"Yes Ms Baxter," the car replied in a smooth silky female voice. 
Anne gave a smile, Rachel Martin would do anything for money 
these days. Anne felt the car move off and onto the freeway. 
Anne's own car was nowhere near this advanced and anyway 
she preferred to drive herself. Anyway was there any other way 
to drive a late 2000 model year Porsche?

"Car, dim the windows and play track 4, no video, audio only."

Anne sat back into her chair, closed her eyes and started to 
listen. This was just the song that matched how she felt at the 
moment.

        "I stood close enough to hear you say
	'Do as the beautiful ones do'
	Tore out my picture from its frame
	I just wanted to be one of you

	Standing on the outside
	Lookin'
	Lookin'
	Funny how you see the truth
	But the feeling does come back
	To you

	She's crazy as anyone can be
	That's what they say
	They say of me
	Wanting love can make one do
	Isn't my fault
	Heredity

	Standing on the outside
	Lookin'
	Lookin'
	State of grace
	State of sin
	Standing on the outside
	Lookin'
	Lookin'
	I cannot feel a single thing
	But the feeling does come back
	Again

	This morning feels like yesterday
	Yesterday follows me around
	Where do you go where no one cares
	Six feet under
	Underground

	Standing on the outside
	Lookin'
	Lookin'
	State of grace
	State of sin
	Standing on the outside
	Lookin'
	Lookin'
	I cannot feel a single thing
	But the feeling will come back
	Again - again"

-- o -- o -- o--

"So your parents worked for fifteen years to send you here?" 
Elizabeth asked. It was now nearly eleven pm and they had 
been talking for hours. Elizabeth felt relieved things were going 
so well. Later on in the week when she called Kat she would 
describe Angela as 'normal'. But for now Elizabeth was just glad 
to have someone her own age who she could just be herself 
with. Of course it was early days but, judging by the signs it was 
going very well. Her only point of reference for this kind of 
friendship was the sisterly bond between her mom and Auntie 
Cathline. Although her friendship with Angela was a long way 
from being that close it did have a positive beginning and that 
Elizabeth decided was more than she'd hoped for.  

"Yeah. I determined to work my hardest so that their sacrifice 
wasn't wasted. I've borrowed a PDA, brought the cheapest e-
books I could find and promised I'd pay them back every Euro 
they gave me."

"I've had to pay for myself to be here. Sure mom and dad give 
me an allowance but my tuition fees and everything else comes 
from my own money." Elizabeth stated.

"Gave you a million to play with did they?" Angela said with no 
hint of sarcasm or malice.

"I wish. They looked at what the average student needs and 
gave me that amount. They made it damn clear that if I needed 
anymore then I'd have to work for it."

"Whoa that's tough!" Angela said. She was surprised. She had 
expected the famous Elizabeth Stephens to be on a sum fit for a 
princess.

"You don't know the half of it. Sure I've got my Beckham-Kline 
outfits and Armani skirt-pants but I had these before I became 
a student here. My mom and dad are adamant. They had to 
make it by themselves so I have to. "

"That's a tough lesson, but fair I guess. Tell me are they like 
they are portrayed in the past. Did the things they say happen 
really happen?" Angela asked.

"If you mean do I believe what they tell me or what other people 
have said, I believe mom and dad every time. It's no accident 
who I look like. I saw photos of dad and Mom when they were 
transformed. I've seen Auntie Cathline's ruined eye and I've 
seen more evidence of Dr Bexley's evil than I care to think of. 
Sure she redeemed herself to the world at the end but not 
before causing a lot of people a lot of pain"

"You sound bitter against her. She's been dead for twenty years 
and I was always told she emerged a heroine. Her final act of 
stopping a war was seen as a triumph and her tragic suicide just 
added to the mythos," Angela said. 

Elizabeth shrugged, "Sure that's the way the history books tell it 
but what people don't get is that it should never have happened 
in the first place. Even Mom and Dad have a rose tinted view of 
her now, they say that she strengthened their relationship 
beyond what it would have ever become and that probably the 
destruction of Tel-Aviv and Cairo would have happened at some 
point in time anyway."

"They are probably correct. At the time it was seen as a great 
horror but sooner or later somebody was going to use a genetic 
weapon and nuclear ones too. That's the benefit of hindsight. We 
know the socio-economics of the time and can work backwards 
from there. A Middle East conflict was inevitable.  If the Guild 
didn't do it, Iraq would, if Iraq wouldn't then somebody else 
would. As soon as somebody found a way to create a genetic 
weapon then it's going to get used. Dr Bexley just happened to 
be in the wrong place at the wrong time. In some ways she was 
there are the right time, your parents too", Angela stated.

"That maybe and that's what the history books teach but I still 
hate her for what she put Mom, Dad and Cathline thru. Mom 
used to call her 'hell bitch' and that name suits her just fine," 
Elizabeth was showing real emotion now. In some ways she 
wanted to tell Angela the truth about her relationship to Dr 
Bexley but that was one secret she was determined to keep.  

"Remind me never to cross you," Angela said with a smile.

Elizabeth grinned back, "Hey no problem. I'm beat and we've 
got a big day tomorrow. See you in the refectory at midday?"

Angela nodded her agreement. Like Elizabeth she was pleased 
with the way things had started off. 

-- o -- o -- o--

The first week or so of Elizabeth's course went surprisingly 
quickly. Cambridge was a fascinating city with so much history 
that Elizabeth couldn't help but fall in love with the place. It was 
so wonderfully quirky and full of tradition, most of which people 
hadn't a clue where they came from but performed anyway. 
There were innumerable book shops, still selling paper bound 
copies and little markets tucked quietly away in the corner of 
some ancient cobbled street. She had spent a number of free 
periods in the museums and still admitted she hadn't even 
scratched the surface. She and Angela had enjoyed a quiet 
picnic by "the backs" a secluded stretch of green straddled by 
the clear, slow moving river Cam and had booked next week to 
go for a punting trip down the river. At the moment her studies 
were lightweight but she knew as the weeks drew on the the 
pace would rapidly ramp up. For the moment she lapped up 
every second of the olde worlde atmosphere of the ancient city.

She was now spread out on the sofa, she had put away her 
Beckham-Klines for special occasions and had splashed out on 
the de-facto student attire of denim jeans and baggy sweater. 
Her new hairstyle still felt strange and she missed her long 
flowing locks, but the shorter style was more practical and 
attracted less attention. Angela had wanted her to go blonde but 
this was too radical a move for her at the moment. It did give her 
a rather 'girl next door' look but she didn't mind. She wanted to 
move away from the old Elizabeth and find her own way. She 
was a little sad that her parents hadn't yet had time to visit but 
she suspected that this was their plan all along. This suited her 
just fine at the moment, she was relishing her independence 
although she was glad that at least Angela shared her 
neurology class. She gave a yawn and reflected on her 
relationship with Angela. For two people of such disparate 
backgrounds they shared a lot of common views. Angela had 
soon lost her starstruck awe of her and that Elizabeth thought 
was a welcome change. Angela treated her for who she was not 
where she came from. 

Elizabeth had had childhood friends. Alex was one of her 
closest in spite of all his teasing but Angela was rapidly 
becoming one of her 'inner circle'. Of course she had told no 
one about her real origins, that would ruin everything. It shouldn't 
have made much difference to her who her mother was but in 
the back of her mind she couldn't help but worry if she was 
destined to turn out like her. What worried her most was that by 
all account the hell bitch's parents hadn't been much different 
from her own.  If they had been powerless to stop what 
happened to Elizabeth then surely hers would be too. Elizabeth 
knew that she couldn't help but be hurt somewhere along the 
line she just wondered how far that hurt would need to run.

At the age of eighteen her parents had given her the 
responsibility for choosing whether to take the Olanzapine or 
not. Initially she had chosen not to but as it dawned on her that 
environment or not she had the same mental flaw that caused 
the Hell bitch to wreak so much havoc she owed it to herself and 
any future partner not to take that risk. So, everyday she 
dutifully took her Olanzapine, it would be foolish not to. Angela 
had asked what it was and Elizabeth had told her it was her 
Asthma medicine. It was even specially stamped with the wrong 
label so that a casual glance couldn't give it away. 

Elizabeth's train of thought was interrupted by a loud knock on 
the door. Wearily she got up and answered the door. On seeing 
who it was she gave a whoop of joy and embraced the couple at 
the door. "MOM, DAD you came!"

"Hi little mite," Matthew said with a smile. It had been too long 
since he'd seen his number one daughter.

"I like the hair. It makes you look a little stern but a lot more 
mature," Kat commented.

"How, how?" Elizabeth started. She never expected to see them 
this early on. She'd been told they'd visit in a month or so.

Matthew gave a smile "We took a detour on our way over to 
Manhattan. We thought we'd drop in and see how you were 
doing." 

"Please come in, it's a little bit of a mess. Where's little bro?"

"Thanks. John's at Yale. He couldn't make it over but I'm sure 
you'll see him at the end of the semester," Kat gave Elizabeth's 
apartment the once over. The little bit of mess Elizabeth was 
referring to was two unwashed coffee cups on table. 

"Nice place. How's the roomie working out?" Matthew asked, 
taking a seat on the sofa.

"Angela? She's great. When I first heard I was getting a 
roommate I was afraid that I'd get some prissy English girl but 
Angela's not like that at all. She should be back soon, I'm sure 
you'll like her," Elizabeth looked guiltily at the coffee cups and 
discretely put them into the kitchen area. 

"It's ok Liz. You are allowed to be messy sometimes. I thought it 
was traditional for a student," Kat said.

"That's what Angela says. You should see her room. It's a tip. 
She does clear away the meal things though which is the main 
thing."

"That's my girl. Never a thing out of place," Matthew grinned.

"How's the course going. Not too much hard work is it?" Kat 
asked.

"Is anything ever hard work for me? Not really, they're still in 
ramp up mode at the moment so I'll have a better idea in a 
month's time. Cambridge is wonderful, so much history, and the 
quality of the research is nothing like we have back home," 
Elizabeth enthused.

Kat put on her serious mother-daughter chat face, "Cathline told 
me you were feeling a little abandoned when you first got here. 
You seemed to be building up to a fight with her when Alex 
walked in. Are you ok now?"

"I guess so Mom. I wish you didn't live either side of a continent 
or ocean, there's so much I want to tell and show you, but I can't 
because you're over there and usually too busy to leave," 
Elizabeth said sadly. As always her mom had gotten right to the 
heart of how she felt. Sometimes it was infuriating but other 
times like now it was a welcome relief. Cathline had told her she 
felt exactly the same way about Kat sometimes. It was one of 
her mother's defining character traits.

"It works both ways Elizabeth. We need to give you enough 
slack and freedom to find out who you are but be there if and 
when you fall. It's a delicate balance and it's one we'll admit we 
haven't got right yet. Not with you and not with John. All we can 
do is hope we've given you enough to know what's right and 
wrong and to use compassion, wisdom and courage that we 
know is in you. It looks to us that you're doing just fine. We have 
our own lives to live just as you have yours. But the thing is, 
the real thing to hold onto is that we are there for you, and if we 
should ever need it you are there for us. That's what family is all 
about," Kat said in her most reassuring voice.

Elizabeth felt relieved at this. Kat had a way of sorting things out 
in just the right way. "Mom I'm worried about me. I feel like a 
time-bomb about to go off. I'm so scared to get into any kind of 
deep friendship with anyone, just in case they hurt me and I go 
and strike back. When the hell bitch struck back, people died."

"Are you talking about this Angela?" Matthew asked.

"I guess so. She's tried to fix me up with a date a couple of 
times but I've turned them all down. Is it right for me to feel like 
this?"

Kat placed a hand on Elizabeth's leg to reassure her. "You can't 
keep holding people at arms length. You'll end up a very lonely 
and shallow person otherwise. What's the point in being able to 
feel, talk and love if you can't share them with anyone? You may 
as well be a robot, devoid of any emotions or the qualities that 
determine our humanity, Take Alex for example. Do you know 
why he treats you like a kid sister?"

"Because he hates me? Thinks I'm a pain in the ass?" Elizabeth 
answered.  

Kat gave Elizabeth a smile, "Alex doesn't hate you. He may 
think you're a pain in the ass sometimes and he'd be right. He 
asked me a while back how to reach out to you. He doesn't 
understand you. His teasing is his defense mechanism. He 
wants to be closer to you, to really get to know who the real 
Elizabeth Cathline Stephens is, but you've spent all your life 
pushing him away."

"He never told me any of this," Elizabeth stated. What was mom 
driving at?

"He wouldn't. He cares too much about you to put pressure on 
you like that. He wants to be your friend, but on your terms."

"You mean he's got the hots for me?" Elizabeth said. Surely 
not!

"I don't think so. You two grew up together and in some respects 
treat each other like brothers and sisters so of course there's 
going to be a bit of good natured needling. But in any good 
friendship there should be a serious sharing of thoughts and 
feelings. I'm not telling you what to do but If I were you next time 
Alex visits take him out to dinner. Wow him with how much of a 
wonderful young woman you've become."

Elizabeth had a mental image of her sitting down at a restaurant 
table with Alex and sharing a candlelit dinner. The image made 
her smile. What a ridiculous thought!

Kat saw what her daughter was thinking and commented "All i'm 
saying is open up to people. This Angela sounds fun, start 
sharing with her, do something impulsive for a change. Sure you 
can have picnics by the river and that's an important part of a 
friendship but you need to move on. Do you know how you 
prevent becoming the reincarnation of the hell bitch?"

"Kill myself?" Elizabeth said cynically. 

Kat gave a concerned look at Matthew, "If you tried that I 
WOULD be worried. No, you start by sharing with those you 
trust. Then when the hurt comes you are prepared for it, it will 
hurt but you will have the friends around you to help you out. 
Notice that Dr Bexley had no real friends before she met 
Cathline and Matthew. When the hurt came she reacted like a 
spoilt child. Before Matthew jilted her she'd never been 
wounded before. For a woman of her obvious intelligence she 
was very naive. Lizzy, put down your roots of trust in those you 
love and care for. Us, Auntie Cathline or anybody you feel you 
can lean on when the tough times come." 

Now it was Matthew's turn to say something, "Your moms right. 
Start to live a little. Learn to trust more, learn to love more and 
learn that from the pain you emerge stronger and a better 
person than you were before."

Elizabeth thought for a few moments, "So you're saying that we 
need pain, hurt and conflict in our lives in order to grow. If that's 
the case why do people who are always getting hurt are in such 
a mess?"

Kat gave a smile. Elizabeth had nearly got it, "It's a question of 
balance. The trick is, to work out the balance for yourself. And 
nobody, not even us can tell you where that is."  

"I need to work this out for myself right?" Elizabeth questioned.

"Fraid so little mite," Matthew quipped.

Elizabeth sat in silence for a minute or so. Her parents were 
right. She had to take the next step but why was she so afraid 
to?

Again Kat read her thoughts, "Scary isn't it? Let me tell you 
something. When I knew your dad had been turned into Dr 
Bexley it'd scared me so much I didn't know what to do. Sure I 
was as mad as hell and sure I was concerned for his safety but 
one thought I remember going around and around in my mind 
was 'Yes I love him but can I go thru with this?' I spent the days 
leading up to Xmas in my old house in mourning for what I'd 
lost. Although I might learn to love again I knew deep down it 
wouldn't be the same. I don't know how to describe how 
Matthew and I feel about each other but the only term I know 
that fits is 'soul mate' I feel as though Matthew and I have waited 
throughout all eternity to meet each other. It was that depth of 
feeling that drove me to stand by him no matter what. But to 
reach that stage I had to take it one step at time and do 
whatever it took to get there."

"I guess so mom. I'll try." Elizabeth said softly.

"That's my girl. Kat I think it's time we were going," Matthew said 
with smile.

Angela walking in interrupted the conversation. On seeing 
Matthew and Kat she almost took a step backwards in surprise. 

Kat cast her eyes over Elizabeth's roommate. She was nearly 
as tall as Elizabeth was and had a similar shaped face. Her hair 
was raven black and a pair of intelligent looking green eyes 
looked back at her. It took a few moments for Angela to register 
and then she held out her hand, "Hi, you must be Elizabeth's 
parents?"

"This is Matthew and I'm Jane," Kat replied returning Angela's 
handshake.

"Elizabeth been dishing the dirt on me has she? How I never 
tidy up, always leave my clothes in a heap on the floor, and 
convince her to have her hair chopped short," Angela said with 
a warm smile.

"If you can convince Elizabeth to do anything she doesn't want 
to do then you're better than we are," Matthew joked.

"Dad," Elizabeth complained as though she was still fifteen.

"Elizabeth, we're in New London for another day. I'm told there's 
a direct train into Kings Cross. Should only take an hour. We're 
staying in the penthouse of the Langam Hilton. We'd love it if 
you'd join us for dinner tomorrow.  Angela can come too if she 
wants," Kat offered.

"Thanks mom I'll come. Angela you want to meet the 'olds'?" 
Elizabeth asked.

"I think I'll pass. It's about time I did some work," Angela 
commented. 

"But Angela, this is the Langam Hilton. Think about it -- world class 
food, health spa's, rejuv-sauna's everything. It'll be great," 
Elizabeth pleaded. 

"You've got the brains to cruise all year, I'm afraid I haven't. Mr 
and Mrs Stephens thank you so much for the offer and if it were 
last week then I'd be there already."

"We understand. Maybe next time," Matthew concluded.

"Elizabeth, we've transferred a little bit extra into your account 
for you to buy something nice for the meal. See ya tomorrow 
about eight?, " Kat smiled at Elizabeth and gave her a hug.

"Bye mom, Bye dad," Elizabeth said and gave Matthew another 
rib bursting hug.

"Maybe we'll get chance to get to know you better next time. 
Nice meeting you Angela," Kat gave Angela a goodbye wave, 
Angela just smiled in return.

Elizabeth followed Matthew and Kat down the stairs and waved 
to them as they drew off in their hire car. She slowly walked up 
the steps and found Angela eating the last remaining null-fat 
chocolate bar. 

"You could've been a little bit more civil to them?" Elizabeth 
complained.

"What?" Angela stated.

"They offered to treat you to a thousand Euro meal and you turn 
them down. Work my ass. You're assignments don't start until 
next week," Elizabeth sniped.

"I'd rather have had the money. Besides, you need to spend 
some time with them without me getting in the way. Tell me on a 
scale of one to ten, how anarchic are you feeling? Want to do 
something REALLY impulsive and downright stupid?" 

"Why?" Elizabeth said suspiciously.

"Look at this. I thought we might go," Angela held up her PDA 
and showed Elizabeth the screen.

"WHAT!  Have you lost your stupid limey brain?" Elizabeth 
almost shouted.

"It'd make the meeting interesting for them. Wouldn't it?" Angela 
said with a mischievous glint in her eye. "Besides, we start work 
proper next week, we won't get much chance for living on the 
edge for a while AND so the flyer says they have a special visit 
by the chief priest or whatever he's called," Angela's green eyes 
were gleaming with mischief and devil may care.

"It'd make me dead that's what it would. You seriously expect 
me to walk into a Children of Bexley rally?" Elizabeth was 
incredulous. This idea was madness. Every fiber of her being 
hated the thought of going and yet a small part of her reveled in 
the sheer devilment of it.

"I've got this coat you can wear, it's got one of those hoods. I 
thought we'd wait until they were in full flow. You would stand up 
to leave and accidentally let your hood drop. Imagine the look 
on their faces when they saw it was Dr Bexley's look alike in 
among them."

Elizabeth's mischievous part was now starting to assert itself, 
"But they hate mom and dad. They say it was their fault, that the 
whole thing was some con trick to get their hands on the hell 
bitches money. They would kill me or at least hold me hostage."

"Don't be stupid -- they haven't tried yet have they? They're justa 
harmless bunch of wacko's. Let's find out what they really think 
about you. I'll set my PDA on instant alarm, and you can do the 
same. Come on, you know you want to. You can get them back 
for all the grief they gave you over your blood tests, mental 
profile, and every other test they forced you to have just to 
disprove them."

"Instant alarm huh. Payback's a bitch isn't it?"

"In this case, a hell bitch," Angela said with a smile.

What the hell Elizabeth thought and gave Angela a confirmatory 
smile.

Angela gave Elizabeth her spare coat and Elizabeth placed the 
hood over her head. It covered up most of her head and left only 
her blue-gray eyes showing. 

"PDA set to instant alarm. Call emergency 211 in the event of 
my heart stopping or the next keypress," Angela said.

Elizabeth repeated the command. From a position of fear she 
was now basking in the thrill of the forbidden and downright 
dangerous. She had never done anything like this before. 
Normally she was so logical and precise but this was more 
impulsive than she had ever been in her life. The tingling 
sensation of fear was an addictive one. Her parents had warned 
her against having anything to do with the Children of Bexley 
cult. Elizabeth knew that her life as she knew it would be over if 
they found out whom she was really descended from. That's 
what made this all the more thrilling. 

They took the autobus to a small city called Ely, some fifteen 
miles from Cambridge. It was far enough away not to let the cult 
members know where they came from but close enough for a 
quick getaway if required. Elizabeth and Angela were silent 
during the twenty minute trip. Soon they were outside of an old 
car dealership in the middle of town. It had been converted into 
a meeting place and people were streaming in. Elizabeth could 
hardly keep herself from running back to the bus station. The 
butterflies in her stomach were multiplying with every step and it 
was all she could do to keep down a scream. Angela clutched 
hold of her arm and Elizabeth felt reassured that she was there. 

As she approached the door she held her head down and took 
the paper flyer a well dressed man at the door passed to her. 
Her head still down she took a seat at the back and as far away 
from the 'congregation' as she could. By now there were about 
two or three hundred people of all walks of life. They were sitting 
down quietly waiting for the meeting to start.

"I want to leave," Elizabeth whispered to Angela.

"Shh it's starting," Angela said and gave Elizabeth's arm a 
squeeze. Elizabeth's nerves were catching.

One by one the people rose and clapped as a man dressed in a 
smart Armani suit walked onto the stage. His goatee beard was 
newly clipped and his blue-gray eyes surveyed the sea of 
people in front of him. Just looking at him Elizabeth could feel 
the charisma of the man. She knew that just by listening to his 
voice those of weaker will would believe anything he told them. 
There was something supernatural about his demeanor, and 
caught up in the rising tide of cheering and clapping, Elizabeth 
felt herself joining in. She cast a glance at Angela. She too had 
been unable to resist the groundswell of emotion pouring out 
into the room.

The man beckoned for them to sit and Elizabeth did so. She 
saw the man glance again across the room and she hurriedly 
avoided his gaze. The last thing she wanted to do was reveal 
herself. She decided she would sit tight and listen and then 
leave. It had been a grave mistake to come here. 

Elizabeth felt Angela's grip tighten on her arm once more. The 
man had started to speak.

"Thank you all for coming. It's been a long trip for me and I know 
it has for many of you. For those new here let me introduce 
myself. My name is James Adams and I am currently the one 
honored to be called the leader of the Children of Bexley. From 
when I was young and my mother showed me the results of the 
second Bexley trial I knew that this woman had something to 
teach us."

"Yeah how to kill people," Elizabeth whispered.

"Shh this is fun," Angela said.

"Her life was an extraordinary testament of triumph over 
adversity. We all know the records of the Fury have been 
tampered with in order to protect those who robbed Dr Bexley of 
her inheritance. For those who are unsure let me put forward a 
few facts.

Firstly, If this DNA machine ever existed where is it now? Once 
invented things do not un-invent themselves.

Secondly the altering of a person at the genetic level goes 
against all known laws of molecular biology. For those that are 
interested you can pull down a detailed e-book on it. 

Thirdly. It's interesting that those who were so called affected by 
the Fury all received multi million dollar payouts without having to 
go thru the courts to get it!. 

Fourthly, There are no records and biopsies of the so-called 
changelings. We have no one's say so that they ever existed.

Fifthly the agent used to destroy Tel-Aviv was not a genetic 
warhead but a highly corrosive acid, condensed into a fine mist."

The man paused to let his facts sink in. "He's right about the 
DNA bit," Elizabeth stated, "Nobody's ever worked out how Dr 
Bexley managed it."

"Then there's the sixth fact. The use of prosthetics and cosmetic 
surgery was nearly as advanced as it is now. The only way a 
double of Dr Bexley could be created was by use of those 
methods."

"Angela I want to go now," Elizabeth stated. 

"Not yet, I'll give you the nudge," Angela whispered back.

"Anyway I hope I have given you enough to think about. There 
are about another twenty or so facts but I won't bore you with 
them Use your PDA's to get to http://www.come.to/children-of-
bexley and read all the evidence for yourself. 

You've seen the pictures of Matthew and Jane Stephens on the 
campaign trail with senator Jameson. What a fine upright couple 
they make. So would you if you had used the deviousness of 
the devil to rob an innocent woman and kill her parents on their 
way to a mercy mission."

Anger grew inside Elizabeth and she could take no more. It had 
been a mistake to come here. Not for her safety, but this whole 
charade was a gross insult to the memories of those who had 
been killed. She felt Angela pull her down but she shrugged off 
her arm.

"THAT'S A LIE!" Elizabeth roared and flung her hood back. Her 
face was red with fury and her blue-gray eyes had a murderous 
glint in them.

The man on the platform looked shocked for a moment and 
Elizabeth felt every eye in the room turn and face her. Those 
eyes widened and gasps of shock echoed around the room. The 
man had already composed himself and said in his most 
persuasive voice, "Tell me your name child"

"My name is Elizabeth Cathline Stephens and what you just said 
was a perversion of the truth and an insult to everyone who died 
trying to stop your precious Dr Bexley," Elizabeth's voice was a 
quiet menacing hiss. 

Angela looked up at Elizabeth. She had seen pictures of Dr 
Bexley and now Elizabeth looked as murderous and as deadly 
as her late namesake ever did. She felt a cold shiver run down 
her spine. What had she done?

The man said in his most placating voice, "Ladies and 
gentlemen we are greatly honored tonight. The daughter of our 
revered mother is here amongst us. Please join me in showing 
your true feelings."

Elizabeth put her hand into her pocket, ready to trigger the PDA, 
but saw to her amazement that the man on the platform had got 
down on bended knee. One by one everyone in the room save 
Angela was kneeling in front of her. Elizabeth could hear the 
whisperings of "Blessed mother thank you" and "Welcome 
daughter of the most high mother". The chants of praise to 
Elizabeth grew louder and louder and Elizabeth felt her soul rise 
with the sound of her praise. It was a feeling like none she had 
ever encountered. Elizabeth found her arms outstretched as if 
accepting all the praise that was being directed at her. It was an 
intoxicating feeling and one that Elizabeth never wanted to end.

Before things go too much out of hand Angela stood up and 
dragged a mesmerized Elizabeth out of the room and onto the 
street. Away from the chanting Elizabeth's head cleared, "What 
the fuck was that," she swore.

"You tell me? They were worshipping you!" Angela exclaimed

"Cool wasn't it! Promise me one thing," Elizabeth asked

"What's that?"

"I don't EVER want to go back there again, " Elizabeth muttered. 
The feeling of anger had left her elated and the praise as though 
she were some goddess had left a hook in her that she found 
she didn't want to remove. 

Elizabeth was sullen on the bus back to Cambridge. She didn't 
want to explore the feelings that the meeting had awakened in 
her. The feelings of power, of being an unstoppable force of 
destiny and of hurt simmered inside her. How dare they call her 
parent's murderers and thieves? 

"Elizabeth I'm sorry. I thought it'd be a laugh. I don't know what 
to say," The image of Elizabeth in full fury was imbedded in her mind. 

"You don't have to say anything. How can they believe such 
things? You've met mom and dad did they seem like they had 
arranged the murder of someone's parents just to steal some 
money? I don't get it, they've never done anything to harm 
anyone, why pick on them?" Elizabeth's anger was slowly 
turning to sorrow and confusion.

Angela grabbed hold of Elizabeth's arm and moved closer to 
comfort the now crying Elizabeth, "Of course they're not. People 
are odd and do things we might least expect and want them to. 
You've known what these people believed from when you were 
young it can't have been that much of a shock to you."

Elizabeth felt comforted by Angela's arm on hers. She put her 
head on Angela's shoulder feeling her smooth hair against her 
head, "Hmm you've been using my shampoo again."

"Guilty," Angela retorted, "I've just had a thought. You knew 
about this at an intellectual level but never at a personal one. 
Anyone else would have just walked out or at least said your 
piece and then walked out. Why did you stay? If you hated it so 
much why did you stay there and lap up their worship as though 
you were really Dr Bexley's daughter?"

"Look if you had four hundred people singing your praises I'm 
sure you'd be flattered," Elizabeth retorted. The feelings of 
exhalation were beginning to surface again. Elizabeth quickly 
put them down and continued.

"Maybe but you sure as hell enjoyed it. I'm so sorry I put you 
through that. There was one moment when you looked so much 
like the 'hell bitch' it ran my blood cold. I've seen photos of her 
and up until that moment you looked like her, same eyes, nose 
everything but you had a certain air of naivete about you."

"Now what do you see?"

"The naivete has gone, at least for the moment. Don't worry too 
much you're probably tired," Angela comforted Elizabeth once 
more. She could feel Elizabeth's gentle crying on her shoulders 
and it was all she could do not to join her. She was responsible 
for the shattering of her friend's innocence and nothing she 
could think of could make her feel better about it.

They walked back arm in arm. Well, Angela was nearly carrying 
Elizabeth along. Elizabeth's eyes were red with tears and her 
normal upright, confident stance had gone - replaced by a 
despondent stooping walk. They arrived back at the apartment 
and Angela unlocked the door and walked inside. She switched 
on the coffee machine, retrieved some ice cream from the 
cooler and handed Elizabeth a bowl and a spoon.

"What's this for? I just want to go to bed," Elizabeth said, 
starting to get up.

"No you don't, not yet," Angela stated

"Make me," Elizabeth whispered.

"What can I say to make this better," Angela asked.

"Goodnight Elizabeth."

Angela had an idea. It was only a glimmering of one and it 
would require a leap of faith on her part. "Elizabeth, I want to tell 
you something. "

"What's that?"

Angela looked right at Elizabeth and said softly, "I know the 
reason why you are so hurt about tonight. You've never trusted 
anyone, ever. The only people you trust are your mom and dad 
and they're a safe option for you. You know they love you and 
will no matter what. When that guy said what he did about them 
for a moment, just for a moment you believed him. Even the 
trust you had built up for your parents wasn't enough to make 
you doubt them when faced with a charismatic speaker of some 
dumb cult. That's why you got hurt. You are ashamed of 
yourself for believing him even for a moment, ashamed of 
enjoying all the praise you were getting and shit scared that you 
might turn out like the hell bitch. But there's no way you can, the 
tests proved otherwise."

Elizabeth stayed silent. If only Angela knew the truth. She 
sought to divert Angela away, "Mom was telling me the same 
thing today. You're right, I need to trust someone, open myself 
up to someone otherwise every single bitchy comment or lie will 
get to me right here," Elizabeth pointed at her heart.

Angela sat down beside Elizabeth and made eye contact with 
her, "Let me be that person. I don't know what it is but we just 
connect you're becoming like a sister to me.  Here I'll go first. 
This is a secret that nobody except my parents know. If it got out 
I'll lose my grant money, everything so I trust you with it. Fifteen 
years of work and sacrifice by my parents will be wasted if this 
gets out."

"What is it?" Elizabeth asked. She felt relieved that Angela had 
made the first move.

"I'm adopted. My parents never registered me with the 
authorities. They were afraid I'd be taken away from them if they 
did. They got a forged birth entry and everything for me. If this 
were ever found out I'd lose my grant and my parents would 
face jail.  They found me in the park, I was barely a few hours 
old and nearly frozen to death. They took me in and raised me 
as their own. I've no idea who my real family is or was but they 
obviously didn't want me. Now mum and dad are the only family 
I have or even want."

Angela's open admission had taken Elizabeth by surprise. What 
she had just told her put her in a position of power over her. Just 
one small slip and Angela Holden and her family were finished. 
Elizabeth felt extremely flattered to be told such a thing. She 
thought back what she'd been told about her mom and auntie 
Cathline's friendship. How it had grown in a short space of time 
to the point where it was nearly has strong as that between hers 
and Matthew's. Kat was right, it was about time she trusted 
someone else. But could Angela be trusted with her darkest 
secret?  Elizabeth considered the options, of any one she had 
met, even Alex; Angela was the one person who had left herself 
vulnerable to her. It was a big step for Angela to take and just 
maybe it was time for her to take one of her own.

Elizabeth took a deep breath "Angela, what I'm about to tell you 
is so secret that only three people in the world know about it. In 
the same way as your life would be ruined if I told anyone about 
your adoption then mine would be also. I would become an 
exile, shunned by everyone I met and probably have to live my 
life under armed guard."

Angela's eyes opened in curiosity. What was Elizabeth going to 
say?

Elizabeth stood up, ensured that the curtains were closed and 
walked over to check that nobody was listening at the door. She 
took her PDA out and started to write.

"You were right about my reasons for being scared and angry at 
the rally tonight."

"I knew that," Angela exclaimed.

Here goes Elizabeth thought and continued to write "All except 
one thing. Me being scared of turning out like the hell bitch."

"What were you scared about then," Angela asked?

Elizabeth shook her head as if to say wait and then continued to 
write, "I cannot turn out like the hell bitch, because I AM the hell 
bitch."

Angela stared at Elizabeth and started to back away, "No! That's 
not possible! She's dead! The tests!"

Fresh tears formed in Elizabeth's eyes and she stood up and 
stood in front of a very shocked looking Angela. Elizabeth 
continued to write. 

"Of course she's dead! BUT every strand of my DNA is the 
same as HERS."

"But I was told you were a clone of your dad?" Angela replied

Elizabeth scrubbed the writing from her PDA and started to write 
on a clear screen, "That too was falsified. My dad has an IQ of 
around 120 while mine is over 160. My brain is exactly the same 
as HERS, right down to the same flaw that triggered the fury. As 
for the tests they were rigged in order to cover this up. That's 
why I was worried about the rally. If it can happen to HER it can 
happen to ME!"

"I don't believe you," Angela was nearly in tears. She had 
opened herself up, laid herself bare and now was Elizabeth 
lying to her?

Elizabeth spoke for the first time. Her voice shaking and full of 
apprehension, "Believe it, " she walked into her bedroom and 
came out a few seconds later with a bottle of small white pills. 
"What's this?" she asked.

"Your asthma medicine. You take it every day," Angela replied.

Elizabeth shook her head and mouthed "Olanzapine"

It was the last word Angela heard before she fainted. The 
combined trauma of the last few hours, the extreme tiredness 
she felt and now this revelation was just too much .

-- o -- o -- o--

Kat was unable to get to sleep, in spite of her plush 
surroundings she was finding it hard to get comfortable. She 
was worried about Elizabeth. She just hoped she'd done the 
right thing by telling her to trust more, step out in trust to 
someone and to be a little bit more impulsive. She couldn't help 
but worry Elizabeth might do something stupid and ruin 
everything. 

Cathline was due to visit next week and perform her usual 
counterbalance role. Their bringing up of Elizabeth was entering 
its most crucial phase, the transition from a girl to a woman.  

Her fears were allayed a little by Elizabeth's room mate Angela. 
She seemed to be level headed and just the person Elizabeth 
needed to trust. Kat wasn't really worried about Elizabeth 
becoming another Dr Bexley it took an extreme situation to 
trigger than off, it was more the other side of Elizabeth she was 
concerned about. Elizabeth's emotional immaturity was the main 
issue. Elizabeth had never loved or even had a romantic 
relationship with anyone. The fear of them hurting her or the 
other way around ran deep in her. In a way, Kat thought that 
was their fault. They had hammered home what might happen 
for so long, had they stifled Elizabeth's emotional growth?

Kat considered that they had, probably out of their own fear put 
the fear of God into Elizabeth about her true mother. Should they 
now withdraw more and let things take their own course? That 
certainly seemed to be the preferable option. Keep an eye 
on her and drop in from time to time. Kat though she needed to 
take some of her own advice. She had to learn to trust that 
Elizabeth knew what she was doing.  Kat checked the bedside 
clock it was nearly 4am she really must try and get some sleep. 

-- o -- o -- o--

Elizabeth awoke early the next morning. After carrying the still 
unconscious Angela to her bed she had just managed to make it 
to her own bed before collapsing in a heap. That had been one 
hell of a night! Had her admission ruined the blooming 
friendship between her and Angela? There was only one way to 
find out. 

"I thought I'd make you breakfast in bed," Elizabeth said 
carrying in a tray of muslei and a steaming hot cup of coffee.

Angela sat up in bed and took the tray, "Thanks, you needn't 
have."

"We need to talk. Not here, somewhere private. Look about last 
night, I...," Elizabeth started.

"It's ok. I was just a little shocked that's all. Let me eat this, 
throw on some clothes, and we'll go out for a walk,"

"Deal," Elizabeth smiled. That had gone easier than she expected.

Elizabeth decided that she needed cheering up so she fished 
out her best Beckham-Kline outfit, straightened out what 
remained of her hair and applied some makeup. It felt good to 
feel smart for a change. This living in jeans, cheap skirt-pants, 
and sweaters was making her feel less like a woman and more 
like a garage sale. 

Angela emerged wearing her standard issue jeans and T shirt 
she took a mock step back in amazement as she saw Elizabeth 
standing there looking like a million dollars. From the cut of her 
skirt-pants to the exquisite cut of her blouse Elizabeth looked 
every inch the millionaire's daughter.  Angela had never noticed 
before how Elizabeth's face had an air of supreme confidence 
about it, of infallible intellect and of determination to succeed at 
any cost. 

"Ready?" Elizabeth asked.

"You look, you look amazing. I need to change," Angela stated, 
and turned to go into her room.

"No you don't! I just wanted to give the non-dowdy me an air, 
that's all. Come on, let's go, I've got a lecture at 11." Elizabeth 
smiled and beckoned for Angela to follow her.

They talked about this and that and Angela nearly blurted her 
coffee out when Elizabeth told her that her outfit had cost about 
twenty thousand dollars. To Angela it rubbed in the gulf that was 
still between them. They reached a secluded cake shop and sat 
down outside. The summer was wearing a bit thin now but even 
in this early October day it was pleasantly warm. Elizabeth had 
gotten wolf whistles and looks from nearly every man they 
passed. Angela decided that dressing this way was Elizabeth's 
attempt to feel normal again. As they sat down and waited for 
the croissant's to arrive Elizabeth asked, "Well?"

"Well what?" Angela replied taking a sip of her cappuccino.

"Last night. We need to clear the air. I need to know where we 
stand?"

"The same as before. I'm sorry for that fainting business -- it made 
it seem worse than it is. I'm not worried about being stabbed 
while I sleep if that's what you are concerned about. So my 
roomie is the hell bitches daughter. So what! You might have 
been gay, or even worse American!," Angela teased. 

"But I am Amer...," Elizabeth started.

"I know you are. I just want you to know that you did the right 
thing telling me. You're secret is safe with me. At least you know 
who your mother is. See, to me, it's the environment you come 
from not which set of genes you have. Hell, I could be Dr 
Bexley's illegitimate daughter for all I know BUT I do know that I 
was brought up very well and love my family. It makes no odds 
to someone who's adopted which set of genes a person has. It's 
who they are that's the important thing and you young lady are 
far too well adjusted, clever and compassionate to ever be a hell 
bitch," Angela saw that her words had had the desired effect. 
Elizabeth now looked a lot happier than she had before.

"Thanks Angela. I was really worried when I woke up this 
morning. I was afraid I'd blown it both with you and with the 
whole cult thing."

Angela shook her head as if to disprove Elizabeth's statement, 
"Now I understand why you reacted like you did. Hearing them 
talk about your parents like that and then them treating you like 
some kind of goddess must have really spooked you. Knowing 
who you are makes the whole thing ten times worse."

"So there's not any part of you that's the least bit worried about 
me?" Elizabeth asked.

"Listen witch, I am worried about you but not about the hell bitch 
thing," 

"Then what!" Elizabeth demanded.

"There's a very cute guy over there who hasn't been able to take 
his eyes off you since we got here and you haven't even smiled 
at him," Angela smiled at Elizabeth.

Elizabeth gave Angela A big grin, the relief of being accepted for 
who she really was like a weight that had been lifted from her. At 
long last she was starting to feel free of the ghost of Dr 
Elizabeth Anne Bexley.

-- o -- o -- o--

Anne climbed up the ladder into the gently rocking boat. She 
had spent an exhilarating couple of hours taking samples of 
invertebrates and coral from the Med. They were always the first 
to feel the effects of pollution. Her re-breather was almost 
exhausted, as she was. It wasn't the shell fish, coral and other 
invertebrates that gave her the buzz, it was the experience of 
freedom and of oneness with nature. Wearily she stripped off 
her wetsuit, revealing her bikini and tanned body. She walked 
into the laboratory area and saw Steve, her colleague poring 
over a computer screen.

"How's it looking?" She asked.

"Not good. Fuel cell number three is playing up. I'm getting a 
'Main Bus B Undervolt' warning light on the main panel. We 
should be ok for the trip back but I'll go look at it in a while. As 
for the samples, Sulfur levels have risen by nearly eight per cent 
since 1992. Mercury is up too and as for the O2 content that's 
down by four per cent. The Vesuvius eruption back in 08 didn't 
help much. Most of this, what we're seeing here, is down to that. 
But for these poor guys it doesn't matter where it comes from. 
Only that it makes their life a lot harder," Steve gestured to the 
array of sample jars littering the lab table.

"I know. First of all the bacteria are affected, then the plankton, 
then the invertebrates and it just cascades down from there and 
before you know it the whole ecosystem has collapsed. We 
know what's going on but with our current tech and funding we 
can't stop it. There's nothing we can do about volcanic activity 
but what we're doing to the ocean sure as hell isn't helping," 
Anne said bitterly.

"If what we think is happening here is actually happening then 
we may have a chance to save the ecosystem but it'll take 
another twenty years before we can really start work. By the 
way, how's the new re-breathers working out?" Steve asked. He 
cared about the impending collapse of the global marine 
ecosystems as much as Anne did but Anne was by far the more 
fanatical about it. 

"Great! No mucking around with decompression, heavy tanks or 
worrying about running out of air. They must have cost a 
fortune. It's nearly as good as having gills."

"And of course you'd know what having gills was like?" Steve 
teased.

"Ok I'll let you go down next time ok," Anne said taking the hint.

Steve plucked up courage to ask a question he had been dying 
to ask since he first saw this tall, blonde and stunningly beautiful 
research student. Even after an exhausting two hour dive she 
glowed. Steve had to admit that there were elements of a 
younger Rachel Martin about her but Anne was far more 
realistic than that image of impossible female perfection.

"Anne?"

"Yep?" Anne replied. She was busy tying her hair back into its 
characteristic ponytail.

Here goes, Steve thought, "I was wondering if you'd like to have 
dinner with me?"

"I have dinner with you every day" Anne replied. 

"No! I meant Dinner, candles, restaurant y'know."

"You mean a date?" Anne asked.

Now Steve was even more worried, "umm yes, if you like."

Anne gave Steve a smile, "How do you know I'm not some kind 
of nightmare cannibal surf babe? You know virtually nothing 
about me."

"But I want to find out. We've been working together for nearly 
six weeks and you've told me nothing about yourself," Steve 
stated.

"There's nothing to tell. My parents died several years ago. I'm 
putting myself thru college using the money they left behind," 
Anne said. She was not sure at all if she wanted to get back into 
the dating game, let alone with Steve.

"Ok let me take you out as a friend then." Back to plan B Steve 
thought.

Anne had an impulsive thought, "No I'll go as your date. It's 
about time I had a little fun." 

Steve couldn't believe his ears, "That's, that's great! We're due 
back at 6 so I guess I'll pick you up at 8."

Anne gave Steve a devastating smile, "That'd be great. Now 
back to business. We've got to go back to the traps we sent just 
back on the continental shelf just off of Netanya. It should only 
take us a couple of hours to get there. That should give me time 
to recharge the re-breathers and to have a rest."

"Hey when is it my turn?" Steve complained

"Over dinner. I do the diving, you do the paying," Anne smiled.

Steve shook his head in mock disbelief. How could such a 
wonderful woman as Anne Baxter ever agree to go out with 
him? However unlikely it seemed, she just had.

-- o -- o -- o--

"Welcome Ms Stephens. Your parents are at a table in the 
garden atrium," the doorman gestured for Elizabeth to turn to 
the left. 

Elizabeth gave the doorman a thank you smile and walked into 
the exquisite surroundings of the Langam Hilton. She felt just 
like the hotel looked, just like a million dollars. Her new outfit 
was absolutely stunning in conception. It hung on her as though 
suspended by an invisible thread, went in, and out in all the right 
places. The slit in the dress up her right leg exposed her 
shapely thigh, and the fact the dress left her entire back exposed 
save the curve of her ass made her the image of every 
teenager's wet dream.  Angela had been blown away by its 
elegance as she was picked by limousine from outside of her 
apartment. Angela had asked how much the outfit and 
hairstyling had cost but Elizabeth had refused. Fifty thousand 
Euro's was a lot of money -- all Elizabeth would say that it was 
enough. When getting dressed Elizabeth had noticed she was 
getting a little out of shape and vowed to spend at least two 
hours a day in the pool and gym to keep herself in tip top shape.

As she walked into the marble floored atrium she caught sight of 
Matthew and Kat laughing over a bottle of champagne. At the 
sight of her Matthew shook his head in mock disapproval while 
Kat just mouth "WOW".

Elizabeth smiled, she knew she looked wow. It made her feel 
better. A waiter saw her approach the table, and offered her a 
seat next to Kat. Elizabeth sat down, poured herself a glass of 
champagne and breathed a sigh of relief.

"You ok little mite?" Matthew asked.

"Just tired that's all, " Elizabeth said, taking a sip of the still cold 
champagne.

"You could have saved some of that fifty grand we gave you. At 
this rate we'll be broke and living in single roomed apartment in 
Delaware," Matthew stated.

"Sorry dad. Mom did say get something nice."

"I'm not telling you off but Angela must have felt awful. There 
aren't many students who walk around in designer outfits or go 
to six star restaurants for meals," Matthew said.

They were interrupted by a very smart looking waiter who 
passed them the menus, swapped the bottle of champagne for 
a new one, and then retreated to allow his honored guests some 
time to consider their choices.

"Why come here? We could've gone to a place in Cambridge or 
New London?" Elizabeth asked.

Kat nodded, "Yes we could have but we wanted to give you a 
treat. We haven't seen you for nearly two months and wanted 
the chance to be a real family again. We're helping senator 
Jameson prepare for his presidential campaign, and so as that 
ramps up we'll have less and less time to visit you. We're sorry 
that we can't spend all the time with you, but this is important."

Elizabeth understood that Kat was saying 'you're a big girl 
now'. She thought for a few moments, considered all the options 
and then said, "Mom, Dad, last night I did two very stupid things. 
Well one was very stupid the other hasn't turned out too bad so 
far."

"What did you do? Did you have a fight with Angela?" Kat 
asked.

"Worse. Angela thought it would be a laugh if we went to a 
Children of Bexley Rally," Elizabeth said guiltily.

"WHAT!" Matthew roared, and then looked hurriedly around at 
the rest of the guests staring at them.

"I'm sorry dad. It seemed like a fun thing to do, to get them all 
wound up, get them back for all the grief they put us thru." 
Elizabeth knew she'd be in a for hard time but honesty was 
always the best policy, especially when parents were 
concerned.

"What happened?" Kat asked, the concern was evident on her 
face. "Did they hurt you?"

"No, that was the thing. We sat there and listened to their high 
priest or whatever he's called. He started saying all these 
horrible things about you and I just lost it. I stood up and called 
him a liar."

"Then what did he do?"

"He bowed down and worshipped me. He called me Dr Bexley's 
daughter. They don't know, do they?" Elizabeth said worriedly.

"How can they know? Even a DNA test doesn't give any hint of 
who you are. You have to combine a CAT scan with DNA tests 
in order to pick up the difference in yours and Matthew's brain 
structure. We are the only people with that information. What on 
earth made you do such a stupid stunt?" Kat said, trying to 
placate Elizabeth's concern.

"I was trying to step out in trust, be a little impulsive just like you 
said. Besides, I was getting too old and boring. I needed a thrill," 
Elizabeth said defensively.

"You get that side from your mother. Then what happened?" 
Matthew quipped.  

"Angela got spooked, I mean really spooked and dragged me 
out, then we went home."

"How did you feel when they said those things and when they 
were worshipping you?" Kat asked curiously.

Elizabeth had heard that tone several times before. It was Kat's 
way of acting out of curiosity but not showing the deep heart felt 
concern she was really feeling. "I felt furious at them. I wanted 
to take them down for what they were saying about you and 
then when they were kneeling down in front of me calling me 
blessed daughter and all that I felt elated. It was as if I was 
being lifted up into the heavenly realms. Angela pulled me out 
before I was sucked in any more."

"Sounds as though she did the right thing. You have been taking 
your asthma medicine haven't you?" Matthew stated.

"Of course. Look you guys would be mad if you heard what they 
said and to have four hundred people kneeling in front of you 
was, shall we say a unique experience," Elizabeth game 
Matthew a 'come on I'm ok now' kind of look.

"So what's the second stupid thing you did?" Kat asked wearily.

"I told Angela who I really was. She'd opened up to me and told 
me her innermost secret and I need to trust someone. I've 
chosen her. Are you going to bawl me out about that one?"

Kat shook her head, "No. That's a positive step. Not that you 
should be telling everyone, but we trust you're a good judge of 
character. I am angry about what they accuse Matthew, Cathline 
and me of. To answer the other question, yes I would probably have 
hit the roof. Cathline certainly would. I wouldn't worry too much 
about it. As long as you stay away from them you'll be fine."

"Mom, Dad?" Elizabeth queried.

"Yep?" Matthew asked.

"I love you", Elizabeth said with a tear in her eye. They always 
had a way of making everything seem much better.

-- o -- o -- o--

"GPS makes the spot! We're here!" Steve called out to Anne, 
who was busily attaching the small cylindrical re-breathers to the 
belt of her wetsuit. 

"Ok. How far from the coast are we?" Anne called out.

"About forty miles, "It'll take a couple of hours to get back but 
this shouldn't take long. Fuel Cell three still playing up. I'll have a 
go at fixing or replacing it while you're busy with the fishes," 
Steve said. Had Anne forgotten about their date already?

"If we can get it going it'd be great. I'd hate to be stranded out 
here with a nice free meal waiting for me, "Anne smiled.

So she hadn't forgotten. "I thought you'd be paying, seeing as 
your always saying what a twenty first century woman you are" 

Anne gave Steve another heart melting smile, "I may live the 
third millennium but when it comes to matters of the heart, 
stomach and especially money I'm strictly second millennium."

Steve gave his best smile in return. It was going well. "Whatever 
you say dear. Now are we going to get those traps or not?"

"Ok. Want to check everything for me?" Anne asked. When 
diving alone the cardinal rule was to have someone else check 
you're equipment and let them know exactly what you planned 
to do and go.

"Sure," Steve walked up and started checking Anne's re-breathers, 
depth gauge, emergency air, a length of rope, shark repellant, 
and all the other gear she had on. He tried not to notice how 
snugly her wetsuit stuck to her skin or how the shape of her was 
as close to perfection as he could imagine. Now was not the 
time for distractions -- someone's life depended on how well he 
checked the equipment. A few moments later he announced, 
"You're fine. See you in an hour. I'll replace fuel cell three while 
you've gone. Bye."

Anne gave the ok signal and climbed down the ladder. After, 
clearing her mask, ducking underwater and testing the 
functionality of the re-breathers she gave Steve a last 'ok' signal  
and swam beneath the waves.

It took her almost twenty minutes to reach the crustacean traps 
they had laid a few days before. The plan was to catch a few 
lobsters, crabs or octopus and analyze them for signs of being 
affected by degradation of O2 in the water. One by one they 
were empty. That was odd, she thought they should have been 
mostly all full. Surely the population hadn't degraded that much 
since the last survey was done a year ago? 

After another five minutes she found two traps that contained a 
lobster each, so she untied them from the mooring anchor and 
went to inspect the others. They too were empty. She checked 
her watch; it was time to be heading back.  She still had time to 
have a quick detour, Steve wouldn't mind. This close to the sea 
floor there must be something interesting to see. She slowly 
swam downwards, thankful that she didn't have to suffer 
decompression. She swam down until she could hardly see the 
hand in front of her face. Strange the water shouldn't be this 
murky? She switched on the powerful flashlight attached to her 
wrist and proceeded to explore. What had caused this 
disturbance?

The water grew ever darker and more churned up as she swam 
on. Every instinct told her to withdraw. Don't mess with what you 
don't understand was the rule that had been drummed into her. 
She could feel her heart beat getting quicker and quicker until it 
seemed to make the water vibrate. She found herself 
hyperventilating. The re-breathers could only take so much 
oxygen from the water; if she didn't calm down she would 
overload them. She stopped swimming for a few moments to 
calm herself down -- after all the sea was her friend. It and she had 
been long time companions and she told herself that the bond 
between them would still be there. This had the desired effect 
and she then continued on. Suddenly she felt something touch 
her leg and almost screamed in shock. She whirled around to 
see what it was and saw only murky water. Steeling herself and 
overcome with curiosity she swam down to where she thought 
the object had gone. A few seconds later she saw a large object 
about six feet in length and very dim in outline. The current was 
gently carrying it away as though drifting on a breeze.  She 
swam closer to it, shining the flashlight at it all times. Then, right 
out of the murky water leapt the burned remains of someone's 
face. Its skin was almost all gone, as was most of the hair. 
Anne nearly spat out the regulator in horror. She recognized 
what remained of the face. It was Steve!

Putting aside her feelings as best she could she swam towards 
Steve's body. She had to find out what had happened to him. 
Now knowing what to expect it was a little easier when she 
finally managed to get a clear glimpse of his body. A leg was 
missing, as was most of his chest. Her medical training kicked 
in, as did her scientific detachment. It was her defense against 
emotional trauma. Whatever had happened to Steve it had been 
quick and violent. It must have been some kind of explosion. 
Her heart sank; she now knew what had caused the water to be 
all churned up. There had been an explosion on board the boat, 
it had killed Steve, and as the boat sank it churned up the water 
around it. She was alone and stranded forty miles from shore.

Forgetting all about the lobster traps she managed to grab hold 
of Steve's lifeless arm. She owed it to his family to try and return 
his body for them. Working as best as she could she tied the 
rope around his torso and attached the other end to her belt. 
Feeling the weight of Steve's body behind her was making her 
progress slow, and it took her more than half an hour to reach 
the surface.  Anne checked the re-breathers -- they now had less 
than an hours worth of charge left to them. Anne looked around 
to see if she could find anything worth using as a life raft, but 
everything of any size had sunk with the boat. Flares, life rafts 
and everything were now making their way to the bottom of the 
Mediterranean. There would be no telling where or how deep it 
was by now. Judging by the lack of flotsam and debris there 
wouldn't be much recoverable. She couldn't even see the 
emergency mayday beacon that was supposed to deploy in the 
event of the ship sinking. Anne took her bearings from the sun, 
checked her wrist compass. There was nothing else for it. With 
no life preservers, rafts or useable floating material she would 
have to swim until she was picked up, made it to shore or 
drowned. There was one option open to her, it was an extreme 
one and very, very risky but it was she quickly decided, the only 
viable option left. Taking a deep breath she set out towards the 
shore.

-- o -- o -- o--

One Day Later
-----------------------

"That's odd," Wills commented. Pointing at an entry on his PDA

"What is?" Mark asked.

"This dream woman of yours. She's never been ill, gone to 
hospital, had a day off sick or anything," Wills stated.

"So?"

"Just think it's odd that's all. Look I've pulled down everything I 
can find out about her, net white pages everything. Short of 
spending all week at this you've seen everything about her that I 
can find out," 

"Sure, thanks. I owe you one," Mark said. In the last hour or so 
he'd learned lots about his dream woman. Her real name was 
Elizabeth Anne Baxter. She'd lost both parents in an auto 
accident a number of years back. Her SAT scores and grades 
were way above average. She'd studied for a medical degree 
before switching to Marine Biology and Zoology. What else had 
he found out? That was it, she owned a late 2000 model year 
Porsche, very nice. No speeding tickets, convictions or anything. 
Average credit rating for a Ph.D. student, no outstanding debts. 
From what Wills had found out she was just a normal well 
balanced one hundred and ten percent babe.

"Mark I think you should see this. I was looking for any new 
information on her.  Wills voice had dropped to a serious tone. 
He handed over his PDA to a worried looked Mark.

Mark stifled a cry of horror when he read the article.

"Two feared lost as research boat sinks with all hands.

Two promising students were feared dead when they failed to 
return from a routine survey of the Mediterranean. Steven 
Mercer(28) an experienced sailor and marine biology researcher 
and his assistant Elizabeth Anne Baxter(24) are feared lost 
when their boat 'the 'Anna-Maria' failed to rendezvous at the 
agreed point. 

Infra red detection and search and rescue aircraft were sent out 
after Israeli coastguards detected an automatic mayday signal. 
On reaching the last known position of the Anna-Maria, 
wreckage was detected on the ocean floor as were several 
smaller fragments floating on the surface. It is thought that the 
boat exploded due to a faulty fuel cell but the black box recorder 
has yet to be discovered."

"No it can't be true. Not like this," Mark was looking distraught.

"What else does it say," Wills said softly.

Hardly daring to read on Mark continued.

"Divers were dispatched to investigate the wreck and as yet no 
bodies have been found.  The search continues but is being 
hampered by bad weather." 

"They haven't found the bodies yet. But I guess it's only a matter 
of time. I was so sure she was the one." Mark was now in a 
state of shock. 

"Come on Mark, I'll get you a beer," Wills said, helping Mark to 
his feet. 

"I don't feel much like a beer," Mark muttered. He felt as though 
he had been kicked in the stomach and that his life would never 
be the same again.

 -- o -- o -- o--

Elizabeth flopped down on the bed after a hard day's tutorials 
and lectures. The workload had suddenly hit them and neither of 
them had much time for picnics, cult visits or even just chilling 
out.  Elizabeth of course had made light work of her coursework, 
but she had decided to read around the subject and was also 
assisting Angela in hers.

"When was the first successful use of stem cell regeneration for 
severe spinal injuries?" Elizabeth asked.

Angela smiled, knew this one "2001 on Detective Tina Cox. The 
late Dr Elizabeth Bexley performed the operation. She used 
stem cells to re-grow the damaged part of the spine, and so 
restore Detective Cox to full health."

"That's not what it says here. It says a Dr Alice Woodward 
carried out the procedure on Robert Sykes in 2009."

Angela looked puzzled, "So what about Tina Cox? How was she 
cured?

"The late Dr Bexley injected her with a slow acting DNA 
modification drug which slowly regenerated her body. It needed 
to be slow acting because of Detective Cox's critical condition."

Angela shrugged her shoulders "Ok. Fine."

Elizabeth read the next question from her PDA. "Ok, next 
question. Who postulated the 'cold boot' theory for the treatment 
of extreme personality disorders?"

Angela smiled she knew this one, "Dr. Yuri Kopaev of the 
Ivanovo State Medical Academy back in umm 2012."

Elizabeth nodded, "See you do know this stuff. Ok next 
question. What's the theory?"

Angela shrugged "Dunno, something like you induce a deep 
coma and then when they wake up they're better?"

Elizabeth read the answer from her PDA "Close enough. Pass 
me your PDA, and let me have a look at your gene sequencing 
work."

Angela sighed. Elizabeth was so much better at this than she 
was. She reached across and picked up her PDA and passed it 
to Elizabeth

"No the sequence goes ACTTGA not ACCTGA," Elizabeth was 
explaining to Angela.

"Why?"

Elizabeth was getting a little frustrated, "Did you go to the 
lecture? It's all down to the proteins in the nucleic acid, that's 
what makes it switch like that."

"I see. Sorry if I'm being dumb," Angela was finding the course 
hard going now.

"That's ok. I guess I've guess I've just got a natural flair for this 
kind of thing. You wanna take a break?" Elizabeth asked. 
Angela was looking bored and frustrated.

"I'd better not. I need to understand this stuff before next week. 
Would you mind leaving me alone for an hour or so?" Angela 
said. 

"I've a better idea come out for ice cream with me?" Elizabeth 
pleaded.

"No I have to do this?"

"Angela you come out with me and I'll tell you my secret for 
doing all this genetics stuff," Elizabeth knew Angela needed a 
rest. At this rate she would burn out and that would be 
disastrous. 

Angela resigned herself to Elizabeth's pleading. Not that a nice 
ice cream would help things somewhat, "OK you win."

Ten minutes later they were sitting down in their favorite ice 
cream joint, waiting for two oddly named knickerbocker glories. 
"Ok then what's your secret?" Angela demanded.

"Ah ah," Elizabeth shook her head. Not yet,

"I want to say sorry, "Elizabeth said softly.

"What for?"

"The other night. Waltzing around in that outfit like some spoilt 
rich kid. There's you getting more and more wound up that you'll 
fail your parents, and then me looking and acting like I own the 
place. Sorry," Elizabeth felt relieved. That thought had been on 
her mind since two days ago.

"I must admit I did find it odd. But don't worry, if you have it use 
it. I know I can't compete and I don't want to either. I'm happy to 
be me. So if you want to blow fifty grand on an outfit, then that's 
fine as long as you don't expect me to match you, because I 
can't."

"How'd you know the outfit cost fifty grand?" Elizabeth queried.

"You made the inside covers of one of the tabloids. It told me 
where you got it and how much you paid for it. I dunno how your 
parents have done it, but they do a good job of keeping your life 
private," Angela commented.

"I glad it is mostly private. I just give them a few photo's every so 
often and it keeps them happy. Now I promised to show you 
how I do it," Elizabeth said.

"Go on. Is this how your mother did it? Angela asked. 

Elizabeth wasn't hurt by this comment. The thought had crossed 
her mind too and sharing with Angela would help the process, 
"I've no idea. I guess so. It seems so logical that it has to be the 
way."

"Go on then, I'm dying of suspense," Angela said eagerly.

"Ok then. I see the genetic structure in my mind. It's like a 3D 
model. I can rotate it, insert and remove genes, proteins etc at 
will and picture the new form in my mind. It's like when you 
listen to music with your eyes closed. You can feel the way the 
music will flow. I do the same with genetics. Actually I can do it 
with most other things. I use it for organizing my workload, 
decision making and planning. By using my mind modeling as I 
call it I can factor nearly all the permutations of a problem very 
quickly. I see the right path to take even before I've engaged my 
thought processes.  If I process information like HER then it's a 
good guess as to how she was able to out plan and out think 
everyone she encountered."

Angela closed her eyes and concentrated but nothing 
happened, "It's no good," she complained.

Elizabeth thought of another way to try and explain it, "It takes 
practice. I've been doing it since the age of four. Look at this 
way. Mozart could 'think in music'. 'He didn't think 'I'll stick a C 
flat there and then a B'. It flowed from him like writing does an 
author in full flow, like painting a masterpiece does to an artist.  
That's what I'm saying. I can't think in music but I can in 
permutations. Genetics is one long string of permutations, the 
fury was permutations of vengeance, what the hell bitch did to 
try and rectify that was a string of permutations as well. How she 
did what she did wasn't mystical or superhuman she was just 
exceptional at this 'thinking in permutations'".

Angela had a thought, "Are you as exceptional at it as she 
was?"

Elizabeth ignored the unsaid sentence in the question, 'could 
you do what she did?'  Instead she answered,  "In my opinion, 
and from what I've seen of her work before the Fury and at med. 
school I'm even better at it than she was," Elizabeth's tone 
wasn't proud or boastful; she was just stating a fact.

-- o -- o -- o--

"Mr and Mrs Mercer. The body is just thru here," the mortician 
gestured towards an operating table. The shape of a body lay 
underneath a white sheet.

The couple held hands, still in shock and fear as to what they 
might see. Slowly they walked over to the table and lifted the 
sheet. The woman let out a gasp and clutched her husband. His 
face was as white as marble and as emotionless as stone. He 
had just taken the shock in a different way to his wife.
The man was the first to speak, "Yes doctor it's him. We need a 
few moments alone. May we see the woman who recovered the 
body?"

"Sure take as long as you like. I'll be outside when you've done," 
the mortician replied sympathetically.

The man nodded, "Thank you doctor."

In another part of the hospital a very tired, sun burned, and 
disheveled looking Anne Baxter was being quizzed by the 
police, coast guard, and accident investigators.

Anne was very tired and needed to rest and it was beginning to 
show in her voice "As I said before Steve had told me that fuel 
cell number three was playing up and he was going to change it 
while I retrieved the lobster traps. That was the last I knew until I 
saw Steve's body drifting away,"

"Did you see the 'Anna-Maria' when you were down there?" the 
coast guard asked.

"No I was running low on re-breather power and judging by the 
state of all the debris there wasn't much left of it."

The police officer checked his PDA for the notes he'd made 
during the interview, "OK let me get this right. Your boat blows 
up."

Anne nodded wearily.

"You're forty miles from shore with no flares, life boats or life 
preservers."

Anne answered "Yep"

"No fresh water, no food, limited time available to you for your 
re-breathers."

"Correct, officer," Anne replied.

"Officer, where's this leading to? She needs rest, lots of it." The 
doctor who had given Anne the all clear now tried to stop the 
questioning. Anne needed rest desperately. The doctor was 
concerned. They had been questioning Anne for ages and she 
urgently needed her rest.
 

"Humor me doctor", the policeman replied. "Now where were 
we, Oh yes. If that's not enough to handicap you you've got a 
200 pound corpse tied to you."

"I guess so," Anne saw where this was leading to.

"So Ms Baxter please could you tell us how in hell you managed 
to swim forty miles, towing a grown man with no water, no food, 
no life preserver and no life raft. You then turn up, nearly two 
days later up at some fishing village very tired, sunburned but 
otherwise none the worse for your ordeal. That's twenty miles a 
day for two days. Something doesn't add up here," The 
policeman stated. 

"Just what are you trying to say, officer?" Anne demanded.

The policeman continued his line of questioning. "Ok then how 
about this. You're towing a half dismembered corpse, You're a 
target for every shark or barracuda for a hundred miles yet the 
body is untouched and you haven't a mark on you. How come?"

"Are you trying to suggest that I somehow blew the boat up forty 
miles from shore, leaving myself an almost impossible task to 
get back, and to add to that I tow my murder victim's body behind 
me all the way," Anne was now sounding more and more 
outraged. 

"Not at all, just tell us how you did it," the policeman asked.

"I've already told the coast guard, but I'll repeat it just one more 
time. After that read the book," Anne snapped.

"Go on. The PDA is recording, " the policeman stated.

"Ok, first things first. I owed it to Steve to bring his body back to 
his family. I wasn't there when my parents were killed, I never 
got the chance to say goodbye to them, and it's that memory that 
has haunted me ever since. I still had a full compliment of shark 
repellant so I set it to slow release, just enough to mask the 
blood still seeping from him. To make it last longer I stripped off 
my wetsuit, placed the repellant inside his chest and put the 
wetsuit on him. That way he was as sealed in as I could get 
him."

"That was some feat doing all that without dropping anything," 
the policeman said. 

"I did drop a few things. Which is why I was glad of my re-
breather. Anyway, that was Steve dealt with. The next thing on 
the agenda was how in hell was I going to make it back to 
shore. As Mr Coastguard over there knows, over the past year or 
so the pattern of currents is slowly changing. It's been playing 
havoc with fish stock, everything. Anyway because we were 
tracking the plankton we needed to follow the currents quite 
closely."

"I get it!" the coastguard exclaimed,

"Yep. I swam in the current all the time. The amount of 
effort required dropped from a forty mile swim down to a more 
modest thirty. To conserve energy I drifted, swimming only to 
maintain course. Halfway thru the first day I found a piece of 
wood large enough to put Steve onto. After lashing him to it I 
towed it like a raft. Steve didn't need my wetsuit anymore so I 
put it back on. I needed it more than he did. Eventually I 
reached a small fishing village and managed to rise the alarm. 
Are we any closer to finding out what happened?"

The accident investigator shrugged. "We think it was the fuel 
cell. They were a very old design. Our initial guess is that cell 
three must have cracked open. It would have been ok, but 
Steve probably moved it when he replaced it. That could have 
released a large amount of hydrogen and oxygen into the 
engine room. All it would take is a spark from a light switch and 
the whole boat would have gone up. The other fuel cells would 
probably have split too, just adding to the destruction.

"I thought fuel cells were nearly indestructible and have multiple 
failsafes?" the policeman asked.

"They are and they do. I'm not an expert on this, I'm just reading 
what it says here. It's probable that a manufacturing fault was to 
blame, and it only appeared when the cell was being swapped 
out. These things last for years so this may well have been the 
first time it had been swapped out. Anyway, at the moment it 
looks as though moving it caused it to explode. We can't know 
for sure for a while yet. There's not much left to look at."

The conversation was interrupted by a knock at the door. A 
nurse popped her head around the corner, "Anne, Mr and Mrs 
Mercer would like a word with you"

"It's ok. I think we're done here aren't we?" Anne asked 
hopefully.

"I think so. We'll come back tomorrow if that's ok?" the 
policeman stated. Switching off his PDA and putting it inside his 
pocket. The other two men nodded their agreement, collected 
their notes and left the room.

Anne didn't have much time to recover from her grilling, and in 
one way she preferred the all at once approach. She'd had little 
time to think on Steve and how exactly she felt about his loss. 
Her train of thought was lost as a couple dressed in somber 
fashion walked in holding hands. Anne stood up and asked, "Mr 
and Mrs Mercer?"

The man nodded, and sat down on the chair the policeman had 
occupied some moments before. "We've, we've come to say 
thank you," the man's voice was cracking with emotion. His wife, 
her eyes red with tears sat studying Anne.

"That's ok. I'm so, so sorry. I wish I had been there. Maybe I 
could have done more," Anne said softly. 

The woman spoke for the first time. Her voice was quiet and 
shaky, "You did more than anyone ever expected you to do. 
Please don't blame yourself."

"Jo's right. You could have left him at the bottom of the sea but 
you risked your life to bring him back to us. We can bury him 
properly, say good bye properly and remember him, as we 
always will. You have given him back to us, and that is a dept 
we can never repay," The man said. His voice was now firmer 
and calmer than before. 

Anne decided to open up to this people. They needed the 
answers to those questions, "When I was down there and saw 
his body. I could only think of when my parents were killed. I 
was away at the time and never got the chance to say goodbye 
to them properly. It still plays on my mind from time to time that I 
never got that chance. I knew as Steve drifted away from me 
that I had to save some else the same pain that I went thru."

"Thank you is all we can say. What was Steve's mood like when 
you left him?" Jo asked.

Anne saw thru the question 'Did my son die contented? Can I 
regard his life as happy one?'  "He was very happy. He'd asked 
me on a date earlier on in the day. I don't date just anyone, but 
Steve was fun to be around and we got on really well so I'd 
agreed. We'd spent much of the rest of the day talking about it, 
him especially. I'll always remember him in that way. Yes he 
was very happy when I left him"

Jo let out a small stifled sob and was immediately comforted by 
her husband who then said, "Thank you. Steve was a quiet and 
thoughtful son. He was always a little shy around women. The 
fact you agreed to go out with him would have given him more 
pleasure than you can imagine. It helps to think of him that way; 
getting ready for a date with you. I bet he teased you about 
paying, he always wanted to be the gentleman."

Anne gave a smile and nodded. Fresh tears formed in her eyes 
"Yes he did and yes he was, a perfect gentleman. You should 
be very proud of him. We had sent some unusual findings to the 
university. Well they were Steve's findings. I did the diving, he 
did the studying. If they show what we think they show, we have 
a small chance to make a real difference. His life wasn't wasted 
at all."

Jo looked Anne in the eyes, "No it wasn't was it? It brought you 
to us. I'm sure your parents wherever they are would be very 
proud of what you did for Steve and us. Please come to his 
funeral. We want you to come."
   

"Mr and Mrs Mercer?" Anne said.

"Jo and Karl please," Karl replied

"Ok, Jo and Karl. I will be there, I promise," Anne said with such 
determination that Jo and Karl knew that nothing in heaven and 
earth would stop this remarkable young woman from attending 
their son's funeral.

"They told us the boat blew up when Steve went to change the 
fuel cell, is that what you think happened?" Karl asked.

'Did my son cause this?' was how Anne took the question, "The 
fuel cell was old and probably had a defect that only showed it's 
self when it was removed. That's the line they are using at the 
moment. They don't think there's any causative action on it. The 
maintenance was up to date and it had all been checked. It was 
just a terrible accident. Steve wasn't to blame, he always 
checked everything again and again."

Karl scribbled a note down on a scrap of paper, "Ms Baxter, 
here is our address in Utah. We'll send you the funeral details 
as soon as we know them."

"I'll be there," Anne promised.

"We know you will," Karl said quietly.

"We have to leave now, we have so much to prepare and it's the 
hardest job in the world at the moment," Jo stated.

Anne nodded, "Thank you for coming. I appreciate your visit. 
Thank you."

Jo stood up and gave Anne a large hug, "Thank you so much." 
New tears formed in her eyes and Anne returned the embrace. 
The next few days were going to be very hard on Jo and Karl 
Mercer and they would need all the comfort they could get. 

-- o -- o -- o--

The next day Wills, clutching his PDA ran up the five flights of 
stairs to Mark's room. The elevators had been out of order and 
this couldn't wait. Out of breath he managed to rap a staccato 
knock on Mark's door. "Mark. Wake up, " he managed to rasp.

"Mog off!" Mark shouted thru the door.

"Mark open up. There's some news just in," Wills called. He was 
slowly catching his breath.

Wills heard a shuffling sound come to the door and was faced 
with a bedraggled Mark. His hair was unkempt and unwashed. 
Deep dark rings were around each eye and his face looked as 
though it belonged to a much older version of himself, "Uh huh?" 
Mark grunted.

"Look at this!" Wills thrust his PDA into Marks face.  

"I'm not in the mood for games," Mark snarled.

Unable to contain the news any longer Wills blurted "She alive. 
Your dream woman, Anne Baxter she's turned up. A little 
sunburned, utterly exhausted but she IS alive."

"You what! Come in, sorry bout the mess," Mark said. His face 
showing distinct signs of unbelief.

Mark's room was normally quite tidy for a single guy, but this 
looked as though it had been trashed by a drunken, but very 
angry heard of elephants. Clothes were scattered all over the 
floor, mugs were placed on every level surface. An empty Pizza 
box was on the floor, its half eaten contents was still visible as it 
was draped over the side of the box. Wills was a little stunned. 
He had never seen his friend like this before, let alone over a 
woman he'd never even spoken to.

"Mark, Listen to me. She's alive."

"I heard that bit! How come?"

Wills righted a turned over chair and sat himself down on it. 
Mark swept an area clean of socks and underwear and sat 
down facing him. 

Wills read from the PDA, "It seems a fuel cell exploded on her 
boat, killing this Steve Mercer instantly. She was diving at the 
time and literally bumped into his body. Uck!"

"And?" Mark demanded. His hopes were starting to rise from the 
pit of despair they had been in for the past few days.

"Her boat was forty miles from shore when it happened. Woah! 
She swam back to shore towing this guys body!"

Mark gave Wills an incredulous look, "She SWAM back? 
TOWING a guy. Fecking hell Wills, how'd she manage that?"

"Says here she found some wreckage, put his body on it and 
then used currents to drift back to shore. Oh yes, she'd put her 
shark repellant canister inside this guy's body and sealed it in 
with her wetsuit. This prevented her from being attacked as she 
swam. "

Mark's face dropped. 

"Hey, what's up?" Wills asked.

"She is way Way WAY out of my league. She's out of league for 
anybody I know. I've spent some time diving and there is no way 
in hell you do what she did unless you are one hundred and ten 
percent sure that you are going to make it back. You know what 
the real neat point is? She towed the guys body back! I'll say 
that again she towed the guys body back!"

"Your point?" Wills asked. He was failing to see where Mark was 
leading.

"Say that guy was average size and weighs about one ninety 
pounds. That's an extra bodyweight you have to pull. Sure you'll 
lose some when it's floating but still. Yet she was strong enough 
to swim forty miles. After seeing this guy's body underwater she 
doesn't panic or do anything stupid. She sets everything up, 
works out what she is going to do, and then does it."

"Says here she walked out of the sea near a fishing village, As I 
said sun burnt, exhausted but none the worse for wear."

"And another thing. Aircraft were searching for them. They 
would follow the current as that's the way anything would drift so 
why didn't they see her?"

Wills shrugged his shoulders "Dunno."

"SEE what I mean! She's fit enough to swim forty miles, 
resourceful enough to survive in those conditions, cool headed 
enough not to get attacked by sharks and she still has enough 
consideration and forethought for the guy's family to bring his 
body back. As I said, way, way out of my league."

"There's only one sure fire way to find out" Wills stated. He saw 
what Mark had been driving at. This was one hell of a woman.

"How?" Mark asked.

"Wait until the Uber babe comes back in a couple of months."

-- o -- o -- o--

One Week Later
------------------------

Anne Baxter lay stretched out on her bed. Steve's funeral was a 
little over a week away, and attending it was not a pleasant 
thought. Why did everyone she remotely like or care for die on 
her? Sure Steve may not have been husband material, but she 
did get on well with him. She closed her eyes and tried to 
access the part of her that could shut away the death of a close 
friend. She tried to suppress how she felt about what had just 
happened but found that the feelings of loss wouldn't go away. 
Maybe she had been fonder of Steve than she had admitted to 
herself. Maybe it was just the grief and shock making her feel 
this way. She decided that a good compromise was that it was a 
little bit of both.

She reflected back on her survival of the sinking of the "Anna 
Maria". That had been a very stupid thing she'd done. The 
proper thing to do would have been to wait for rescue at the site 
of the wreck, not swim forty miles to shore just because she 
could. The reaction of Steve's parents gave her some comfort. 
She had done the right thing by returning his body to them. It 
would make their grieving process a little easier, but what of her 
grieving process? Was Steve just another death to add to her 
list of those who had came in contact with her? 

It was, she decided self-defeating to think like this. She and 
Steve had performed some important work during their time 
together and nothing could take that away from them. She did 
feel a little guilty about lying to Steve's parents about Steve 
coming up with the idea that could not only remove much of the 
pollution from the world's oceans but also provide an almost 
limitless supply of minerals. That had not been Steve's idea, it 
had been hers. Where it came from didn't matter to her, as long 
as it worked and she was as sure it would as she was that she 
could make that forty mile swim. 

The thought of the work she still had to do brought back 
memories of the previous day's conversation with the dean of 
Tel-Aviv University. He had given the usual platitudes of being 
sorry and how Steve would be greatly missed. 

Anne ran thru the conversation in her mind.

"So what you're saying is that I can't go out anymore but I have 
to do the rest of my tenure here behind a desk?" Anne still felt 
annoyed even a day after the event.

"Ms Baxter. We have no more research vessels free and no 
vacancies on the ones we have. Until the insurance pays up 
then we cannot afford to buy and refit a new boat and even if we 
could, your time would be up before it was ready," The Dean 
was most insistent.

Anne still refused to give up, "But this is important. We were so 
close; even another week on board another ship would be 
enough. We lost all our samples, all the genetic material 
everything in the wreck. Steve managed to save all the work 
we'd done to the off shore archive otherwise we'd be back to 
square one. If you value his memory as much as you say you do 
then you'll let me complete it for him."

"Do you want your Ph.D. or not? If you do then complete it back 
on shore. Otherwise you are free to go back to your college right 
now. You won't even tell the head of faculty what you were 
working on, only that it's a certain Nobel Prize. So how do I 
know that this isn't just some excuse for you to go diving some 
more?"

Anne was getting exasperated. Why would no one trust her? 
"I've told him as much as I can. It's to do with Plankton. Ok fine, 
I'll work from shore but I'll make sure that this university gets 
none of the credit for helping me avert the greatest 
environmental disaster the world has ever seen since the 
extinction of the dinosaurs!"

Anne smiled to herself. She had hit the Dean where it hurt, loss 
of prestige and therefore money.

The Dean still wouldn't give in without a fight "Oh come on, Ms 
Baxter you're exaggerating."

Anne raised an eyebrow in surprise, "Am I? Year on Year 
decline in Plankton reproduction, year on year increase in birth 
defects and sterility amongst the vertebrate and invertebrate 
population, year on year decreases in plant and coral life. This is 
all happening on a global scale. Within the next seventy to one 
hundred years we are facing almost total extinction of all 
complex life forms in all the world's oceans.  Ask Dr Bayan, he'll 
verify what I'm saying is true. He's looked over our data and is 
right now getting ready to pitch to the UN to do something. 
Because if the oceans die then we cannot and will not be far 
behind. Now I will get my research done someway or another. 
I'd rather it be here because all my notes and samples are here, 
but I can just as easily go to Australia and get it done," Anne 
had just left the threat hanging.

"And all you need is a week?"

"Maybe two," Anne had said. 

"Ok you have your two weeks. Just make sure you're right about 
this and damn sure this university gets a mention. You'll replace 
Dr Quenby on board the "Esau" on Monday."

"Thank you, You won't regret it,"

Anne gave a self-satisfied yawn. Today was Sunday, and 
tomorrow she would be back on board a ship; more importantly 
she could get back to the verification of her hunch. She was 
sure it would be met with uproar when it was announced but it 
was the only way. 

Her mind wandered back to Steve once more. He would have 
been delighted at her result in front of the dean. It would be, she 
decided, a fitting memorial to him if she was able to pull it off. His 
death would not have been in vain and this thought made her 
sorrow more bearable.

"Hi-fi, Track 6 personal collection."

The small box in the corner beeped in recognition and started to 
play. Anne closed her eyes and listened to the haunting song.

	'Flying over to the U V A 
	Easy rider, she could dream all day, dream all day 

	Yeah, she's heading all the way to the sun 
	Or far enough to get what she wants 
	Maybe she will, maybe she won't 
	It's easy to say, hard if you don't 

	Flying, gliding to a slow decay,
	Now is nothing when it's yesterday,yesteday   

	Yeah, she's heading all the way to the sun 
	Or far enough to get what she wants 
	Maybe she will, maybe she won't 
	It's easy to say, hard if you don't 

	But you've got to make the most of today 
	For beauty dies young, beauty dies young 

	Yeah, she's heading all the way to the sun 
	Or far enough to get what she wants 
	Maybe she will, maybe she won't 
	It's easy to say, hard if you don't 

	But you've got to make the most of today 
	For beauty dies young 
	But you've got to make the most of today 
	For beauty dies young 
	You've got to make the most of today 
	For beauty dies young, beauty dies young 
        Beauty dies young'         

-- o -- o -- o--

"I don't think this will fit me anymore," Matthew said jokingly, 
pulling out a short nylon skirt.

"Nor this me," Kat joked back showing Matthew a pair of jeans 
with a hole cut out in the rear. That pair of jeans had been made 
for Kat when she was still living as the half tiger and half woman 
creature that Dr Bexley had turned her into, and the hole had 
been for her tail.

"Why'd we keep so much junk?" Matthew asked.

"Dunno. Elizabeth might like your old skirt though."

"Nahh, it's not got a designer label on it. God, I hated wearing 
those things," Matthew stated.

"Not as much as I hated wearing those jeans," Now some 
twenty years after they had been turned back into their 'proper' 
forms they could now joke about it. Well almost.

"I've no idea how long I could've stood being a woman," 
Matthew said gently.

"As long as it took. Matthew, why'd we keep all of HER stuff 
from her old house? She's not going to need it anymore," Kat 
said. 

They had stored all of Dr Bexley's personal belongings 
from her old house just in case any of it would prove useful. 
Now some twenty years later, the time had come to have a 
spring clean. Besides, maybe clearing out Dr Bexley's old 
belongings helped take their mind away from their own 
daughter, so many miles away and so vulnerable.

Matthew shrugged his shoulders, "Seemed like a good idea at 
the time I guess. Just as well we've got enough space to store it. 
Y'know how it is stuff just kinda grows. It was your idea to have 
a clear out anyway."

"Too right!" Kat suggested.

"I think we should auction it off. It'll make a bomb on E-Bay2, " 
Matthew suggested.

"And have all those Children of Bexley freaks fawning all over 
it?  When Cathline next visits in a month or so we'll let her read 
some of the journals. She's into that kinda thing." Kat said. The 
last thing she wanted was to provide that cult with some more 
'sacred' artifacts. 

"Ok, We'll pile all of HER stuff in one corner. All her books, 
clothes and stuff can go over there," Matthew pointed to a 
corner of the room that was less cluttered than the rest. What 
about our stuff?"

"Bin it I guess. It seems a shame to throw away all that history 
but it IS in the past and we need the room. Put it in the opposite 
corner to HER stuff," Kat suggested.
  

"Kat, I'm still worried about Elizabeth," Matthew said. He'd been 
waiting for the right moment to voice his concern.

"Me too. We've done all we can to ensure that she turns out 
alright. Now it's up to her," Kat said softly.

"You think we should tell her?" Matthew suggested.

"Nope. If she knew it would destroy her. It would ensure that she 
really would fail the test. We have to trust her and ourselves."

"I'd hate to lose her," Matthew said sadly

"Me too," Kat said and gave Matthew a comforting hug. It had to 
work out with Elizabeth -- it just had to.

"This is getting much too serious. Hey Kat, you think I'd look 
sexy in this?" Matthew said pulling out a black silky teddy.

"Of course darling," Kat rummaged around for a while and then 
spotted a small booklet. She fished it out and showed it to 
Matthew. "You should have read this first, it might have helped."

Matthew read the cover of the booklet 'Yamaha GP1200 R 
Jetski instructions and guidelines'. "Very funny. I can whip your 
butt any day of the week."

Kat gave a smile. She had comprehensively beaten Matthew in 
every Jetski race they'd ever had. All except one when she'd run 
out of fuel. "Like hell you can."

"Wanna bet. I'll order some new ones up and we can resume 
where we left off."

"Ok Let's finish clearing this up. Elizabeth will be back in a 
month so you'd better order three. You'd better get used to 
finishing last though," Kat smiled at Matthew.

"In case you haven't noticed I'm not a wussy girlie anymore."

"I certainly had," Kat gave Matthew a seductive smile and 
moved in for the kiss. Matthew responded in kind and soon any 
thoughts of clearing up were forgotten.

-- o -- o -- o --

"Elizabeth, That guy over there is still looking at you," Angela 
hissed.

"That he may be, but I'm not interested," Elizabeth replied. The 
guy was cute, real cute though. He was, she estimated, a clean 
six foot, his short cropped blonde hair was neat and his blue 
eyes took in her every detail. 

As if reading her thoughts Angela said, "Look. He's the cutest 
guy in the room. Go talk to him."

"No," Elizabeth said flatly.

"Don't turn round, but he's coming over," Angela whispered

Elizabeth froze. That's the last thing she wanted. Even if the guy 
was cute. She heard the man's footsteps draw closer until he 
pulled up a chair and spoke.

"I'm sorry for staring at you like that."

Elizabeth was a little taken aback, "That's ok." She muttered.

"Thanks, " The man said and stood up to leave.

"Hey," Elizabeth called. Nice ass Elizabeth thought.

The man turned around, "Yes?"

"Why were you staring at me? Don't give me any of this most 
beautiful woman in the room crap either", Elizabeth said 
forcefully. Her blue-gray eyes showing flashes of defiance.

"Bugger, That was my one good line gone," the man joked. His 
English accent had a clipped BBC tone about it. It was strangely 
alluring to Elizabeth.

Elizabeth nearly smiled back but stifled it down.

"If you must know I was wondering where you got your lipstick, 
sorry, lip gloss from. I think it'd suit me." The man's face showed 
amusement.

Now Elizabeth couldn't help but smile, "Actually I think you're 
more a deep red kinda guy than this light plum. Blue eyes and 
deep red definitely go together. I'll give you my stylists card if 
you want," Elizabeth moved a hand towards her purse.

The man was a little taken aback, "Ok, Ok you win. My name's 
Nick and you are?"

Didn't the man read magazines? Elizabeth thought, "Elizabeth."

"Elizabeth, nice name. Who's your friend?"

"Angela. Actually, Elizabeth here was telling me what a cute guy 
you are", Angela said.

Elizabeth shot a soul piercing glare at Angela, but Angela 
ignored her.

Nick caught Elizabeth's glare "Thanks. What are you going 
tomorrow? I'm doing a study on how our best friends can be our 
worst enemies and I'd like your input. Meet me by the river at 
say eight?"

Elizabeth considered his offer. Angela wouldn't rest until she'd 
set her up with some guy at least for one date. She decided that 
Nick was at least a little amusing and seemed like a decent sort. 
After all it was only one date. "Sure why not. I hope you'll use 
real names to protect the guilty."

Nick gave a smile showing a perfect set of teeth, "Deal. Angela 
you are in for it big time. Until tomorrow then,"

Elizabeth gave Nick a stunning smile, "Deal."

-- o -- o -- o --

Elizabeth had now been dating Nick for the past three weeks. The 
first date had gone better than she expected, and in spite of her 
initial reservations she found Nick fun to be with. He shared her 
slightly off the wall sense of humor and was even quite a good 
cook. Elizabeth had originally bawled Angela out over her overt 
matchmaking but had now conceded that it was a good 
thing. She had politely declined Nick's serious advances saying 
that she preferred to wait. Nick was fine about this too.

Nick was studying cybernetics at the Gates College of advanced 
technology. It was a subject Elizabeth found a little dull, 
preferring the infinite and intricate possibilities of DNA and 
medicine. Elizabeth had to admit that some of the theories and 
hardware that were being mooted were seriously cool. Implants 
in the brain that acted as additional memory, implants that 
automatically translated any language into any other language 
and enhanced replacement limbs that were just as or even more 
dexterous than the real thing. If he weren't careful Nick would go 
on for hours about it. Elizabeth would just sit there and listen 
intently, studying his rugged face or contemplating how it was 
that she was slowly but surely falling for him?

It was nearly the end of the semester and Elizabeth was 
wondering what it would be like to leave Angela, Nick and all her 
other friends behind for a month or so. She would miss them 
and Angela had declined her invitation to visit her for a while. 
Angela missed her parents too much even though they hadn't 
visited all semester. 

Elizabeth was sat in front of her PDA, reviewing her end of term 
paper. Angela was out, at the library or doing something else. 
Elizabeth had just read a complex DNA sequence when she 
heard a knock at the door. She recognized the knock. It was 
Nick!

Elizabeth shot up out of her chair and flung open the door. 
Without waiting for Nick's greeting she flung her arms around 
him and gave him a large hug. "Hi"

Elizabeth got a little worried when Nick didn't return the hug. 

"Can I come in?" Nick said solemnly.

Elizabeth's heart was in her mouth. What could be wrong? 
Normally Nick was outgoing and witty. It was those qualities 
Elizabeth liked in him.

"You'd better sit down," Nick said softly. 

Elizabeth did so, a feeling of dread was inside her.

Nick's face dropped "There's no easy way to say or do this so I'll 
put it bluntly. Elizabeth, it's been real fun getting to know you. 
Even better going out with you but I'm afraid I can't go out with 
you any more."

Elizabeth felt liked she'd been hit with a lump hammer and 
kicked in the gut at the same time, "Why? Is it me?"

Nick reached out and clasped Elizabeth's hand. She went to pull 
away but Nick looked her in the eyes and she stopped. "Liz, it's 
not you. Please don't ever think it's you. You're beautiful, witty, 
far more intelligent than I am and I'm sure there's somebody out 
there for you. It's just that, that someone isn't me."

Tears formed in Elizabeth eyes, "You didn't answer me", she 
snapped.

"Hey I'm about to. We're in different worlds. You turn up to our 
first date wearing that 50K outfit of yours, and I turn up wearing 
my best pants and shirt costing all of 100 Euros. Next week 
you're off to your own island while I go back to my parent's semi 
in Basildon. How can it work Liz? I wanted to do this now before 
it got serious and we both got hurt even more."

"I thought we were serious!" Elizabeth sobbed. Never had she 
felt hurt like this before. Could nothing replace the empty space 
inside her? The word she'd heard Angela use when she'd got a 
low mark on an important test was 'gutted'. That was exactly 
how she felt now. As though someone had ripped her heart out 
and left it beating on the floor.

"Liz, please I still care deeply for you. But it wasn't just the gap 
between us. Where were we going?"

Still crying Elizabeth managed to say, "I wanted a chance to 
find out."

"Sorry Liz. I'm not some kinda dump and leave kinda guy. I 
wanted this to work out as much as you did. But it wasn't to be."

Elizabeth gave Nick a glare that shook him to the core. It was a 
glare of such venom and fury that he almost wilted under it, "I 
think you'd better leave?"

Nick still a little shaken by the ferocity of Elizabeth's demeanor 
stood up and turned to leave. His heart was pounding at the 
sight of those blue-gray eyes boring into his soul. They were 
almost demanding blood in return for the pain he'd just inflicted. 
A fear crept through him until he fled from the room. What had he 
just done? 

He could still hear Elizabeth's sobbing as he slammed the door 
shut more in fear than anger and made his way down the 
corridor.

-- o -- o -- o --

Nick was still upset with breaking up with Elizabeth. He had tried 
his best to make it as painless as he could for her but he felt as 
though he had messed the whole thing up. She just hadn't 
understood what he was trying to get at. He knew that she knew 
that his reasons didn't hold water but how could he have told her 
that there was someone else?

It was, he decided better that he lie to her rather than tell her the 
truth. The real truth was that he had met someone a week or so 
ago but couldn't face telling Elizabeth about her. She was 
everything Elizabeth wasn't. She had a fire about her, she was 
from a normal background not some celebrity rich kid, and 
furthermore she didn't creep him out as Elizabeth had so often 
done. 

Yes, he decided he'd done the right thing. Elizabeth was one 
scary woman. She could run rings around him on the 
intelligence front, always seemed to know what he was going to 
do before he did it, and as for that 'look' she gave him, it was right 
from the depths of hell and fury. That didn't mean she wasn't fun 
to be around or that she wasn't a nice person. She was. She 
had compassion, wit, integrity and wisdom, but was also a little 
aloof and austere. 

Nick regretted the way in which he had had to break up with her. 
Maybe he should have told her, but he knew that would hurt her 
more in the long run. It was too late now. He just hoped that 
Elizabeth would get over him and that she could move on. He 
did feel a rat cheating on her like that but how often does true 
love come along, once in a lifetime? He hoped that in the long 
run Elizabeth would understand. 

-- o -- o -- o --

Elizabeth had been inconsolable for three days. Angela had 
tried all the tricks in the book to cheer her up, from ice cream to 
slushy movies. Now with only two days to go before the end of 
the semester it looked as though Angela would be leaving 
Elizabeth just when she needed her the most. Angela's patience 
was starting to wear a little thin with Elizabeth's introspective 
moping.  "Elizabeth, I hate to say this but get a life. Men are 
bastards, we all know that."

"You get a life! I don't see you with many boyfriends!" Elizabeth 
snarled, and gave Angela another one of her soul piercing 
glares.

Elizabeth's comment stung Angela but she shrugged it off. 
"That's because I'm too busy working and trying to pass my 
course. At least Nick had the decency to try and be nice to you. 
He tried to spare your feelings as much as he could."

"You don't believe his reasons he gave me? Because I don't! 
Why did he lie to me?" Fresh tears formed in Elizabeth's eyes.

"I don't either. He probably met someone else and wanted to let 
you down gently. He really cared about you Liz, but he's right, 
sometimes it just doesn't work out. In the end one thing's always 
there to bail us out."

"What's that?" Elizabeth said miserably. 

Angela gave a smile, "Ice cream and chocolate. Yes I know 
that's two but they are inseparable. What'd you say I walk into 
town and get some chocolate fudge cream? We'll have a girls' 
night in to celebrate surviving a whole three months with each 
other."

Elizabeth liked the idea of that. Angela had been her rock during 
her time here. She always seemed to know what would make 
her feel better and was always someone to sound out at. She 
hadn't regretted telling Angela her secret at all and, in fact 
Angela knowing it had helped her start to come to terms with 
losing Nick. Not that she wasn't still as mad as hell with him it's 
just that Angela made you forget your anger for a while and that, 
Elizabeth decided, was just what she needed, "Ok make sure it's 
the good stuff. This is a three tub situation. Oh yes, could you 
pick up my medicine again for us. I just don't seem to be in the 
mood right now," Elizabeth managed a smile.

"Oh at least a three tub. I'll buy four just in case. Your 
prescription's in the usual place right?" Angela smiled, picked 
her purse up and walked out.

Elizabeth stretched her long legs out over the sofa and reclined 
to think. It had been a very long three months and in spite of the 
work, which she had found ridiculously easy; she had enjoyed it. 
The early couple of weeks had been freaky, the memories of the 
Children of Bexley rally were still fresh, as where the feelings 
related to that event. Part of her still felt elated at being 
worshipped like that. This feeling was dimmed by her anger at 
the baseless way they accused her parents of defrauding Dr 
Bexley. 

She was pleased to be able to help Angela out with her studies. 
It had repaid at least in part the help Angela had been to her. 
Angela was clever but really had to work hard to get the good 
grades she needed. In spite of her coaching Angela never 
seemed to be able to get to grips with 'thinking in permutations' 
but that too was fine with her. Elizabeth had missed her parents 
and even Auntie Cathline hadn't visited since that first trip when 
she'd just moved in. She knew that this was a deliberate 
strategy by her parents but that didn't matter. She knew they 
loved her and that they were' doing what they felt was right for 
her. She was a little sad that Alex hadn't been able to come. 
She missed their verbal sparring and the annoying way he 
called her 'kiddo'. No doubt Alex would visit sometime over the 
vacation, and some old scores would be settled and some 
new ones created. She checked her watch fifteen minutes had 
just flown by. Her train of thought was broken by a sharp series 
of knocks at the door. Wearily she stood up and answered it.

"Hello Ms Stephens," A silky smooth voice said.

Elizabeth nearly jumped at the sight of James Adams. Leader of 
the Children of Bexley cult. He had dressed in a sharp Armani 
suit with impeccable tie and shirt. His hair was neatly trimmed 
and his eyes showed a look of friendly concern. 

"Fuck off!" Elizabeth snarled.

"I came to apologize. Please let me come in. I promise no tricks, 
no worship, no anything, just apologies." James said in a 
comforting tone.

"Say what you have to say and then go. PDA Set instant alarm, 
usual parameters." Elizabeth called.

James heard Elizabeth's PDA beep signaling that the police 
would be called the moment Elizabeth desired. That didn't 
bother James. He hadn't come here to make trouble.

"Thank you, " James said and pushed past Elizabeth and sat 
down on the sofa where Elizabeth had just been laying.

"Ok what do want?" Elizabeth said, folding her arms in defiance.

"I wanted to say I'm sorry about what happened at the meeting a 
few months back. It's taken me a while to track you down but 
you must know all that worship stuff wasn't my doing. Sure I feel 
as though Dr Bexley had a great deal to teach us but she was 
not God." James's voice was soft and placating.

Elizabeth unfolded her arms but moved towards the door "It 
wasn't the worship stuff that bothered me. It was the lies about 
mom and dad. I don't hear you saying you're sorry about them."

"Ms Stephens, Elizabeth. In our lives our judgement is clouded 
by our environment, who we are and what we do all affect the 
way we look at things. By all accounts you have a brilliant mind. 
Have you ever turned it to looking at the facts surrounding Dr 
Bexley and your dad's involvement in her life?"

"I don't need to. I've seen the evidence," Elizabeth snapped.

"Only the evidence that you yourself have chosen to believe. If 
you would take a fresh look thru the dispassionate eyes of 
science you would see a lot of the evidence you have been 
shown doesn't hold water. What I'm about to show you is top 
secret. It's been in my possession for a number of years but I 
want to show it you in order to make my point."

"You're not going to convert ME! Elizabeth snapped.

"I'm not wanting to convert you. Just free your mind to other 
possibilities." James pulled out a plastic bag from his inside 
pocket, "What's this?" he asked, showing it to Elizabeth.

"It's a receipt dated 15th July 1997," Elizabeth said.

"What's it for?"

"Cosmetic alteration of a woman called Jane Andrews the sum 
total is fifty two thousand dollars," Elizabeth said suspiciously.

"Can you outline the work performed by the clinic. In lay terms 
please?" James asked.

"Breast, hip and face alteration. Body sculpting and fat re-
distribution and hair transplants. In my opinion this Jane 
Andrews was given a whole new look from head to toe. She was 
remade as someone else," Elizabeth stated.

"Whose is the signature on the bottom of the receipt?" James 
asked. His voice a flat tone, like a lawyer in a court case.

"It's a little hard to make out but it looks like dads," Elizabeth 
voice tailed off as the realization hit her.

"That's right. Jane Andrews is your mother's maiden name and 
the signature at the bottom of the receipt is your dad's. On the 
15th of July 1997 he paid Jane fifty grand to become another 
woman. If you look at the specification of the work done it fits in 
exactly with Dr Elizabeth Bexley's vital stats. Why would he do 
that if not to create some outlandish story about DNA altering?"

Elizabeth stared at the receipt," This, this is a lie. It's a fake," 
She started to blink back tears.

James voice lowered to a comforting tone, "It's no fake. I've had 
it analyzed by the MIT genetics lab. You can check with them if 
you like. The fingerprints and DNA fragments match that of your 
father. He did sign this, the work was performed and I'm afraid 
to say that we have all been lied to. All the time this whole Fury 
thing was a hoax. Why was there no trial in order to ascertain 
who should get Dr Bexley's money after she vanished? 
Elizabeth, listen to me. Do your own research with an open mind 
and you'll see that I'm right."

Elizabeth started to sob. It couldn't be true. It was all a trick. It 
had to be. Her parents were not like that, they would never ever 
do anything like that. Make up a story, kill and discredit for 
money, never!

James put a comforting hand on Elizabeth's "I know it's hard 
and I know you don't trust me I wouldn't if I were in your place. 
All I want you to do your own reading and reach your own 
conclusions."

"Why'd you tell me this?" Elizabeth sniffed.

"Because I want you to know the truth. I know you're not really a 
copy of your dad because DNA altering technology doesn't 
exist."

Elizabeth gave James a defiant glare, as if to say 'so prove
it doesn't!'

James ignored the glare and continued "Before she died Dr Elizabeth
Bexley cloned you from her own DNA. That much is possible. There is
no other explanation for how you look or how you are. You owe it to
yourself and to your mother to find out the truth and let that truth
be known. You are her legacy to us."

Elizabeth tried her hardest to subdue the look of shock she felt. 
THEY KNEW! How in hell could they know about her true 
origins?  What were they going to do with that information? Did 
they want her to join them or at least acknowledge that they had 
some valid points to make? Indeed James did make some valid 
points and she would ask dad about that receipt when she got 
back. What if what she had been told was a lie? Where would 
that leave her? Did she have a greater loyalty to the truth or to 
her parents? 

"I see that you knew you are Dr Elizabeth Bexley's daughter 
already. Don't worry, we're not going to do anything that will 
harm you or the ones you love. You parents have portrayed us 
as the bad guys but they couldn't be more wrong. Even though 
you may not believe us we do care about you Elizabeth, we 
really do. We don't want to see you hurt or lied to. As Dr 
Bexley's heir you are a precious jewel to us. Look, I've said 
enough I can see you are in turmoil over this. Please speak to 
your mom and dad. Ask the questions you know you want 
answers to. Use that exceptional brain of yours to find out what 
really went on twenty years ago," James voice had a soothing 
tone to it and Elizabeth began to feel a little better.

"I still don't," Elizabeth started to say. Her mind was in turmoil. 
Her whole life had been built around what had happened before. 
Her whole view of herself as a potential time bomb had been 
colored by these events, and now this man sitting in front of her 
was telling her otherwise.

James read what she was thinking "That's right Elizabeth. 
You've spent all your life afraid of what you might become and 
now you're starting to realize that you have nothing to be afraid 
of. Since you first knew who you were you've lived in fear, fear 
of what you might do if you trusted and fear of what you might 
do if you loved. That's a terrible burden for anybody let alone 
someone like you. You needn't feel that anymore. If you 
embrace the truth then it will set you free."

Maybe James was right. She had spent her whole life in fear 
and self-loathing. The burden had been a hard one. Elizabeth 
was so tempted to believe what James had to say. To be free of 
the specter of the 'hell bitch' was alluring. But the price she 
would have to pay would be too much, "I can't betray my 
parents," Elizabeth said softly.

James shook his head, "I'm not asking you to. All I'm saying is 
believe that Dr Bexley wasn't the monster the world made out. 
Are you a monster?"

"No, " Elizabeth almost whispered. 

"I believe you. Why don't you believe yourself? It's because 
you've not sought the truth."

"What is the truth?" James's faultless logic, comforting voice 
and wisdom had worn down Elizabeth initial resentment.

James looked Elizabeth in the eyes and said in a voice much 
like her fathers when he wanted to comfort her, "The truth is. Is 
that Dr Elizabeth Anne Bexley was not the monster the world 
has portrayed her as. She was compassionate, gentle and kind. 
I've spoken to those who knew her. They all say she was kind in 
spirit, funny and full of life. She committed suicide so that your 
Mom and dad could live in peace. She knew that no matter what 
she did the world would always remember her as a manipulating 
serial killer and that nothing she did to disprove it would matter. 
It was better she die than try and live disproving a lie that the 
whole world believed.  Elizabeth you are so like her. I can see in 
you the potential she had but was forced to throw away. If you 
tell me to go and leave you alone I promise I will never return. I'll 
leave you in peace but please, please look beyond what you 
have been told. Look into yourself.  Could you ever kill anyone?"

Elizabeth's shook her head, "No I couldn't. I did a study on HER 
once. You are right, she was a lot like me. I think it's time you 
left. I will do as you say, just for completeness. It's best to look 
at both sides before reaching a decision. Can I have that 
receipt?"

"Sorry no. But here's a copy. I've sent you the lab reports from 
MIT as well" James said, reaching into his pocket and handing 
Elizabeth a slip of paper.

At that moment Angela walked in holding a bag of shopping. 
She took one look at James and screamed, "Get the FUCK out 
of here!"

"It's ok I was just leaving." James said, rising to his feet.

"Elizabeth what the fuck is HE doing here. What's he been 
telling you?" Angela demanded.

"He came here to apologize," Elizabeth stated defiantly.

"I must be off. Thank you for your time Elizabeth, "James said 
and strode past Angela and out of the door. 

Angela turned to face Elizabeth once more, "What exactly did 
he tell you?" She demanded.

"He came to apologize to me and then asked me to look at the 
evidence surrounding the fury with a scientific mind. Ignore what 
I'd been told and see for myself."

"And you told him to go shaft himself right?"

Elizabeth shook her head, "He made some valid points. I was as 
surprised as you are."

Elizabeth then outlined her conversation with James.

"I must admit that receipt, if it is valid is mighty suspicious. You'll 
have to let me know what you find. I know we'll work on it 
together," Angela said. 

Elizabeth was relieved that Angela had offered to help. She 
would be her backup in case things went awry.  She couldn't get 
out her mind what James had just said. 'That's right Elizabeth. 
You've spent all your life afraid of what you might become and 
now you're starting to realize that you have nothing to be afraid 
of. Since you first knew who you were you've lived in fear, fear 
of what you might do if you trusted and fear of what you might to 
if you loved. That's a terrible burden for anybody let alone 
someone like you. You needn't feel that anymore. If you 
embrace the truth it will set you free.'

Above all that's all she wanted, to be free.

-- o -- o -- o --

Anne Baxter sat down on the sun lounger by her pool. She had 
treated herself to a few days 'R and R' after a hectic couple of 
weeks on board the "Esau". There had been some resentment 
at her replacing Dr Quenby on such short notice but she had 
soon earned the respect of the crew and researchers. The 
'Esau' was an older design having diesel engines instead of the 
more efficient fuel cells. It also lacked re-breathers, which meant 
she had to spent more time in decompression and limit the 
amount of time she could spend underwater. None of this 
mattered to her now. Her idea had worked, the theory was 
sound and the data gave incontrovertible proof of it. Now all she 
needed was a way to scale it up several million fold without 
damaging the ecosystems she was trying to save.

She hadn't shared her findings with anyone yet, knowing that if 
the idea were exposed early then the political and scientific 
backlash would be considerable. Her only choice was to go for 
industrial backing, which ironically was one of the very things 
that were causing the destruction of the worlds oceans. It would 
take years and millions of dollars to develop the process fully 
and safely but at end of it the result would be almost limitless 
raw materials. Within a hundred years the world would have an 
oceanic ecosystem that was back the way it was several 
hundred years ago. 

Anne felt as though she deserved a few days off. Her tenure still 
had two months to go but she already knew exactly what she 
needed to do. The rest of the two months would be spent in 
writing up her findings and proposals so she could publish them 
when the time came.  Of course the world would think them as 
Steve's idea with her carrying on his work. She didn't mind this 
one bit. It was her ocean she was protecting, not her reputation. 

Thinking about Steve brought back memories of his funeral. As 
she had promised she had attended even though she knew 
nobody there. She had been asked to say a few words and so 
she had said the usual platitudes, which seemed to go down 
well with all the mourning relatives. As a mark of respect she 
had placed a single red rose in his grave and then slowly 
backed away. She had flown back the next day, after a stop 
over in New York to visit her own parent's graves before 
returning to Tel Aviv. 

She thought back to the results of the tests she had performed. 
The plankton had responded even better than she had 
imagined. Anne was feeling not a little smug and satisfied. It's 
not everyday you develop something that could save millions. 
Anne decided to celebrate a little. It had been too long since 
she'd indulged herself. Far too long and what the hell!

"PDA get room service to order me another bottle of 
Champagne. The Bollinger 18 will do. Oh and play track 8 
personal collection."

Anne put the ear piece to her ear sat back and listened to the 
instrumental music track. A big smile was all over her face.
It was good to be back.

-- o -- o -- o --

Elizabeth stood on the bow of the boat watching the sunset over 
the Maldives. She never tired of the view, the infinite variations 
of red, orange and yellow reflected on a turquoise sea. Today's 
sunset was a deep blood red with flecks of orange fire scattered 
at random throughout the sky. Elizabeth was extremely tried 
from the journey. A twelve hour flight from London to Male, 
followed by a four hour boat trip to her parent's island. She had 
been too late to take a chopper over and hadn't thought to 
charter one in advance. Actually she preferred the boat trip. It 
gave her time to clear her mind and to reflect upon what she 
wanted to ask and what she wanted to do. 

The conversation with James, the cult leader had disturbed her 
more than she had first thought. Coming so soon after her 
breakup with Nick it had left her feeling as though she had been 
stretched in all directions at once. She had read the notes the 
cult leader had given her on the way over and had to admit they 
did make a certain degree of sense. She resolved to make it her 
business to find out but first she would unwind. She knew from 
her parents Email that Cathline and Alex would be there too. It 
would be the perfect forum in which to mount her investigations. 
She was still worried about what she would do with the 
information she uncovered if it showed what James had told it 
would. Would or even could she disclose her findings? No she 
decided she wouldn't.  This was to be for her benefit only.

Elizabeth wished Angela were here. She had so wanted to 
share with her the world in which she lived. Sure the island had 
pools, gyms, tennis courts and everything that an exotic resort 
needed but to her it was just 'home'. She checked her watch 
there was still over an hour to go. Elizabeth fished out her new 
PDA. She had spent the remainder of her allowance on 
upgrading it to the latest Sony-Micro-Sun model. Its shiny silver 
metallic case glinted in the sunlight. She thought Nick would like 
it, but then remembered that Nick was no longer part of her life. 

This brought another twinge of sadness as she remembered the 
fun Nick and her had had. Still clutching her PDA she walked to 
a nearby chair and sat down.

"PDA open up a video channel with mom and dad," she said.

The PDA bleeped a few times and eventually Kat's face 
appeared on the small plasma screen. On seeing Elizabeth her 
face broke into a wide smile.

"Hi Mom. I'm on the boat coming over. I've got about an hour 
before they drop me off,"

"Elizabeth! It's great to see you. We've missed you so much. 
Hey, I didn't know they had a vid-phone on that ramshackle 
thing," Kat.

"Dad'll love this. It's my new PDA. It's got a built in satellite vid- 
phone. It is shall we say well cool. Has Cathline and Alex arrived 
yet?"

Kat's face nodded, "They arrived last night. It's so nice to have 
every one back together again. I've sent the servants away for 
the holiday so it's just us for a change. I'd better go this must be 
costing you a fortune."

"Bye mom. See you in an hour or so," Elizabeth gave Kat a 
smile and ended the call. How could anyone remotely think that 
her mom was involved in grand theft and murder? No way! 

Elizabeth decided that she needed to take her mind off things a 
little. Things were getting a little too stressed in her life at the 
moment. Pressure had been building up inside her since she'd 
first got to Cambridge and she had hoped that her few weeks at 
home would enable her to relax a little. Her little conversation 
with James had ruined that idea. She considered the option that 
his visit was timed in order to achieve this. But what did he have 
to gain by ruining her vacation?

Not a lot Elizabeth had decided. He was definitely up to 
something, that much was certain but what? He did make a few 
very good points. Dr Bexley was not the monster she was 
portrayed as. She had come thru in the end to resolve one of 
the twentieth century's closet calls with war. She really did have 
nothing to fear from her. Being like her should be a source of 
pride not of shame. James had been right in that much anyway. 

Too much fear, loathing and distrust had been heaped on Dr 
Elizabeth Bexley and Elizabeth decided that she was guilty of 
that as well. The best way for her to find out what really 
happened all those years ago would be to try and get inside the 
mind of Dr Bexley.  It was something only she could do and 
maybe that's what James was after in her. Somebody who could 
get inside the way she thought and operated in order to 
ascertain the facts. Until her investigations were over she would 
have to act, think and behave like Dr Bexley. No other way 
would give her the insight into whether she could have done 
what she was supposed to have done. It would be a simulation, 
where she could play out scenario's in her mind do see if they 
fitted in with what she knew. A role play with a serious purpose 
in mind, to once and for all silence the critics. 

It could not be a true simulation as she still took her Olanzapine 
and hadn't had the trauma of being jilted like Dr Bexley had. Did 
that matter?

Well yes it did. The whole jilting event had led to events in the 
supposed fury and without that trauma it was very likely that Dr 
Bexley would have gone on to lead a normal life. In order to 
perform the simulation properly she would have to stop taking 
her Olanzapine and generate a traumatic event. The hurt and 
pain of being dumped by Nick was still very much there. Would 
that be enough?

This idea worried Elizabeth. She could see herself getting 
sucked into Dr Bexley's thought patterns and not getting out 
again. She needed another safety net, somebody who knew her 
well enough to know when she was over stepping the mark. Her 
parents and Cathline wouldn't do. They would have a hissy fit if 
they found out. Angela was too far away and Elizabeth expected 
that she'd have the simulation run by the time she returned to 
Cambridge. That only left Alex. Alex was the perfect choice, he 
would know when she was taking it too far and in spite of his 
annoying big brother act he could be trusted. Yes, that would 
work. Alex would be her safety net. 

Elizabeth put all thoughts of the task in hand and set about 
finishing the configuration of her new PDA. The interface was 
still as standard -- she liked to be able view multiple panes of 
information at the same time. It took far too long to look at things 
one at a time. She pressed a small depression in the side of the 
PDA and extracted the small pencil sized wand. This was by far 
the quickest way to draw out exactly how she wanted things to 
be. She did wonder what Dr Bexley would have thought of it. 
No, she told herself; from the time she stopped taking the 
Olanzapine and setting things up with Alex she WAS Dr Bexley. 
Nothing else would work. With that in mind she drew eight small 
boxes on the screen of the PDA. Each one would act as a 
separate or virtual PDA and have all the functionality of the main 
one. Her interface configuration completed it was now time to 
test it. It had been a while since she had used her brain to it's 
full capacity, now it was work out time.

"VPDA1 search and display all personality profile and 
biographical data on Dr Elizabeth Anne Bexley. Born 1969, died 
2001," the top right screen issued a "searching" message.

Elizabeth had already set in her mind the information she 
required.

"VPDA2 search and display all evidence pertaining to the 
creation of the so called DNA altering compound created by 
TGen corp in 1997. Also give complete details on the activities 
of TGen corp during Dr Elizabeth Bexley's tenure there.

"VPDA3 search and display all testimonies and evidence both 
written and aud-vid given in the two Bexley trials.

"VPDA4 search and display personality profiles and biographies 
of Matthew and Jane Stephens. Cathline and John, Richards, 
Robert Abbey, Robin Abbey, Vickie Turner, Stephanie Lane, 
Salah, Detective Scott Harris NYPD, Detective Tina Cox NYPD 
and Senator Walter Jameson.

"VPDA5 search and display all guild records pertaining to the 
provision and use of genetic weapons. Include Guild records on 
Tel-Aviv." 

VPDA6 search and display all UN, governmental and 
international records on the state of DNA research from the 
years 1991 to 1997. Include theoretical information as well.

VPDA7 search and display all known information on the cult 
known as 'The Children Of Bexley'

VPDA8 "Cross reference information from VPDA's 1 thru 7 and 
display commonalties and inconsistencies. Also give suggested 
conclusions to inconsistencies. Zoom out to max pane size 
when complete."

Elizabeth completed giving her PDA instructions. The poor thing 
would be working flat out for the few hours. She was sure that 
people had done similar searches at one time or another but 
she had an advantage she had access to the raw data. She 
closed her eyes and in her minds eye started to form a model of 
the connections she knew were valid. Possibilities and 
permutations danced in front of her as she mentally linked them 
together. The output of these links she formed into new 
connections until it formed a three dimensional model in her 
mind. She knew this wasn't the real thing, she still had 
incomplete information but it would suffice as a rough draft. She 
didn't expect to complete the model first time off; that would take 
several days as Dr Bexley. But when it was complete she would 
know her late mother better than anyone ever did and 
furthermore be able to put to rest any doubts she had about her 
parent's motives and methods. Another byproduct would be that 
it would finally end her fears and enable her to be more open 
and trusting. In short it was the only way she could see that she 
could grow as a person. She concentrated a little more and in 
her mind the model span into greater clarity

Elizabeth was so wrapped up in her thoughts that she hardly 
noticed the boat dock at her parent's Jetty. It wasn't until she felt 
the slight bump as the boat drew up alongside that she mentally 
filed away her simulation and open her eyes. Naturally all the 
family was at the quayside. Matthew holding Kat's hand, her 
brother John standing alongside him. Cathline and Alex were 
there too waiting for her to come ashore. On seeing them she 
gave a smile and a vigorous wave and went down below to 
collect her cases.  

A few minutes later Kat was embracing her and she felt a sigh of 
relief, she was home.

-- o -- o -- o --

Kat had made Elizabeth's favorite for dinner, Cajun Chicken 
salad and as usual it was more than up to standard. Elizabeth 
was ravenous after the trip and ate without speaking a word. 
Elizabeth decided she missed home cooking, especially Cajun 
Chicken salad. 

"It's nice to have everyone back together again," Matthew 
commented.

"Hey Kiddo. I'm sorry I didn't get to see you more, but I had 
other things to do, " Alex said.

Elizabeth was surprised, no insult from Alex. This was a first. 
"That's Ok I missed you too. What do you actually do for a living 
Alex?" she jibed.

Alex gave a grin, "That's for me to know and you to find out."

"Cathline, oh before I forget we had a tidy up of all HER and 
our old stuff.  You want any of it before we burn it?" Kat asked.

Elizabeth nearly choked on her chicken. She needed that stuff. 
Was there anything she could say that would allow her to have it 
without arousing the 'why do you want it?' question. She 
decided to wait until Cathline answered.

"I dunno Kat. It'd take me months to go thru it. I think I've said 
everything that needs to be said," Cathline replied thoughtfully.

"I'll help you," Elizabeth blurted. Actually this was more like a 
considered response. She had toned it in precisely the right way 
to give the 'I want to help but I don't really mind either way' 
inflection.

Cathline considered Elizabeth's request "Ok Liz, you can have 
first look. Let me know if you find anything of interest. See if you 
can find anything of note in HER old journals. She kept 
everything, even her blank notebooks, clothes the lot. She was 
nothing if not thorough,"

Elizabeth's heart leapt. 'yes'. "Thanks Cathline. I would be able 
to spend a lot of time on it but I'll have a go." 

-- o -- o -- o --

Elizabeth awoke the next morning and out of force of habit 
reached over to take her Olanzapine. She had the glass of 
water in her hand ready to swallow the small white pill in her 
mouth when she remembered that she wasn't going to take it 
anymore until her research was completed. In order to allay any 
suspicion she placed the glass of water on the bedside table 
and crushed the pill to a powder. She then drank a small 
amount of the water in order to make her mom think she'd taken 
it. How would she feel after the cumulative effects of the 
Olanzapine wore off? Would she suffer any kind of withdrawal 
symptoms? Her reading had indicated not but everyone's 
physiology was different. Would she be able to perform those 
amazing leaps of logic and intelligence that Dr Bexley had been 
able to do? From her previous research on the fury, not taking 
Stelazine had allowed Dr Bexley to produce some stunning 
discoveries. The closer Dr Bexley came to insanity the more 
devious, intelligent and vicious she became. Elizabeth hoped 
that she could control those tendencies, and if she couldn't there 
was always Alex to bail her out. 

By now her PDA should have produced all the results from her 
searches, so she pulled open the drawer in the bedside table, 
retrieved her PDA and sat down to read. As she had ordered 
VPDA 8 had maximized its display pane and had a list of 
inconstancies based on all her other searches. 

'1. The energy required to perform any kind of DNA 
transformation would result in an extreme exothermic reaction. 
The subject would literally burn up. Conclusion, DNA 
modification as suggested by the late Dr Elizabeth Anne Bexley 
is virtually impossible with current techniques. 

2. If the subject's brain were left intact there is a strong 
possibility of tissue rejection thus causing an almost certain fatal 
reaction within the subject's body. Conclusion, DNA modification 
as suggested by the late Dr Elizabeth Anne Bexley is virtually 
impossible with current techniques. 

3. Every other paper postulating on DNA modification stated that 
modification of the genetic code was impossible once cell 
multiplication had occurred. Conclusion DNA modification as 
suggested by the late Dr Elizabeth Anne Bexley goes against all 
current thinking and current techniques. 

4. Cosmetic alteration could provide an identical copy of a 
person so long as the right subject is chosen. Conclusion, total 
body remolding is only possible by using surgical methods.

5. DNA testing as performed in the late 1990's was not infallible. 
Conclusion, DNA testing is not a foolproof method of 
determining identity.

6. No full copy of the human Genome was published until 2001. 
Conclusion, TGEN had only produced a working draft when they 
announced completion of the human genome project. The draft 
was not enough to be able to control human DNA to the extent 
proposed.

7. No analysis of the agent used on Tel-Aviv is available. 
However significant damage to metallic structures was reported 
in some areas. Fire damage made complete analysis difficult at 
the time. Conclusion, Inconclusive information on the agent 
used on Tel-Aviv. Possibility of genetic warhead use is 
postulated to be less than thirty percent.

8. Records pertaining to the 'fury' are based on personal 
recollection and events. No testimony from Dr Elizabeth Anne 
Bexley was ever obtained. Conclusion, in order to fully verify 
findings more information is required.

9. Even allowing for psychotic behavior, Dr Elizabeth Bexley's 
personality profile prior to the fury does not match that of the 
actions attributed to her. Conclusion, the actions attributed to Dr 
Elizabeth Bexley were carried out by person/s unknown. 
However, there is a small possibility of extreme personality 
disorder in Dr Elizabeth Bexley. Probability of former conclusion, 
greater than eighty percent.

10. Governmental and UN restrictions on data pertaining to 
genetic modification are classified. No further analysis is 
possible.'

11. Records pertaining to persons mentioned in VPDA4 are 
classified. No information available.

Elizabeth skipped to the bottom of the pane.

'Overall Conclusions

Probability of DNA Modification                          2%

Probability of DNA Warhead use on 
Tel-Aviv						30%

Probability of accurate testimony			40%

Probability of Dr Elizabeth Anne Bexley
initiating the events in fury				20%'

Elizabeth gave a low whistle. The numbers didn't look good. 
However the PDA's probability figures were based on processed 
information. They were only as good the information it had found 
and been given. She would need to start her simulation soon. 
She changed her mind about telling Alex of her plan. If he said 
something to her about her behavior then she would know 
something was up. Telling him would only bias his opinion. She 
refused to believe the PDA figures. No way could they be that 
low could they?

Elizabeth swung her long legs out of the bed and looked out of 
the window. The sun had just finished rising and the heat of the 
day was starting to rise. Elizabeth took off her nightdress and 
stepped into her shower. Soon warm soapy water was 
cascading over her body and Elizabeth felt herself relax.

After this quick wake up shower Elizabeth changed into her 
shark skin bikini and went for her now traditional morning swim. 
Dr Bexley had been fastidious to the point of obsession about 
her fitness and reportedly spent many hours a day either in the 
pool or in the gym. Elizabeth decided that she would gradually 
work up to the same routine. She found pushing her body to it's 
limits helped clear her thoughts.

An hour or so later Alex found her, still doing lengths in the 
Olympic sized pool. "You still at it?" he commented.

Not wishing to break up her routine Elizabeth ignored him. If he 
wanted to talk to her he'd have to jog alongside.

"Be like that then. I only came to see if you were ok," Alex said 
grumpily.

Performing a flawless turn Elizabeth set off towards the other 
end of the pool. Should she start work now or wait until 
tomorrow when she was sure the effects of the Olanzapine had 
worn off? She could wait but then there was still a lot of sorting 
to be done and that didn't need her in 'Bexley mode.' Alex had 
caught her up and was saying "Are you OK? You're pushing 
yourself too hard?"

"I'm ok. I'm out of shape," Elizabeth managed to say before 
submerging for a prolonged underwater period. She would try 
and swim the whole length underwater.

"Ok you just seem to be more serious than you used to be. Oh 
well I'm off to watch Matthew and Kat race each other round the 
island," Alex mentioned, and walked off.

You'd be serious if you didn't know who you were, if your 
parents had been keeping something from you and whether 
your real mom was the monster people thought she was, she 
thought to herself. 

Elizabeth swam for a further hour until she felt as though she 
couldn't swim another stroke. Dr Bexley was WAY fitter than she 
was.  Did that matter? Probably not, as Dr Bexley said she 
needed all her strength to cope with the demands of changing 
her body. Still it gave an indication of how far she still had to go. 
After drying herself off she made herself a quick bowl of museli 
and ate it ravenously before making her way into one of the 
spare rooms. 

Matthew and Kat was right, they had cleared it up.
Before she left this room was piled high with twenty years worth 
of rubbish. Now it was all in neat piles with yellow 'stickit' notes 
on each pile. The room had a major division with Matthew and 
Kat stuff on one side and Dr Bexley's on the other. Naturally 
she headed straight towards Dr Bexley's pile. 

One thing caught her attention. A large mahogany chest with 
EAB engraved on the lid. Elizabeth raised an eyebrow, real 
Mahogany. The chest alone would be worth thousands now. 
She sprang it open to reveal clothes all neatly folded into types.

She picked up a short, reddish blue skirt. It was way out of 
fashion now but was still passable as clothing. Elizabeth was a 
little overawed 'SHE wore this. My real mother wore this' she 
thought. 'What were you thinking and doing when you last wore 
this?' Elizabeth tried to imagine Dr Bexley wearing it. She took a 
quick look around and checking no one was looking slipped the 
skirt over her already dry bikini briefs.  'Of course it fits' she 
thought. Already she felt a connection with her late mother, 
'strange how a simple object can evoke so much feeling.'

Elizabeth rummaged around in the chest until she found a 
matching white blouse. 'Would SHE have matched this with 
this?' Elizabeth wondered. Once again checking that the coast 
was clear Elizabeth put the blouse on over her Bikini top. Some 
more rummaging revealed matching shoes, a bra and some 
pantyhose. Elizabeth drew the curtains and got dressed 
properly, putting on Dr Bexley's old bra, skirt, blouse, pantyhose, 
panties and shoes. She dug around a little bit further and found 
a shiny plastic disk in a transparent plastic case. 'Hmm this is a 
CD. How am I going to play this?" Elizabeth thought. She turned 
the case over and saw a series of song titles handwritten on the 
back of the jewel case.

Elizabeth sought out a mirror in the room but found none within 
easy reach. She felt excited as though she was embarking on 
something forbidden, dangerous and downright stupid. She 
quickly ran from the room back to her bedroom, slammed the 
door shut and stood in front of the mirror.

The likeness to the pictures of Dr Bexley was uncanny. Sure her 
hair was shorter but her face, how the clothes looked on her and 
everything was identical. That fact didn't bother Elizabeth -- of 
course she would look the same. What did bother her was how 
her face looked in the mirror. It had lost the soft fun loving lines 
of the girl who'd left here a few months back, and now the eyes 
looking back at her had a sad, haunted look about them. Her 
face too had got harder looking, as Angela had told her. She 
had lost the look of innocence about her. Strangely this didn't 
bother her as much as she thought it would, as Kat had said she 
needed to grow up and find her own place.

Elizabeth posed a few times in front of the mirror. Dr Bexley's 
clothes did really suit her. Maybe it was the clothes that made 
her look a little harder. The pain of losing Nick still riled her -- at 
least he could've told her the truth. She'd read that Dr Bexley 
had often listened to music while she worked. Elizabeth walked 
to where she'd placed the CD and chose the first track on the 
case. 

"Hi-Fi, download and play 'The Queen Of Hollywood' by the 
Corrs'," her stereo beeped a confirmation and started to play

        "She drove a long way through the night 
        From an urban neighborhood 
        She left her mother in a fight 
        For a dream misunderstood 
        And her friends they talk on corners 
        They could never comprehend 

        But there was always something different 
        In the way she held a stare 
        And the pictures that she painted 
        Were of glamour and of flair 
        And her boyfriend though he loved her 
        Knew he couldn't quite fulfill 
        He could never meet her there 

        She's never gonna be like the one before 
        She read it in her stars that there's something more 
        No matter what it takes no matter how she breaks 
        She'll be the Queen of Hollywood 

        And the cynics they will wonder 
        What's the difference with this dream 
        And the dreams of countless others 
        All believing in TV 
        They see their hand prints in a sidewalk 
        Flashing cameras on the scene 
        And a shining limousine 

        She's never gonna be like the one before 
        She read it in her stars that there's something more 
        No matter what it takes no matter how she breaks 
        She'll be the Queen of Hollywood

        She's believing in a dream 
        It's a loaded fantasy 

        Now her mother collects cut-outs 
        And the pictures make her smile 
        But if she saw behind the curtains 
        It could only make her cry 
        She's got hand prints on her body 
        Sad moonbeams in her eyes 
        not so innocent a child."

"Hi-Fi, stop play," Elizabeth said. This was getting scary. The 
song outlined exactly what she felt. She had lived with the 
'Hollywood' lifestyle all her life. Lived with being the appropriate 
term. There were few occasions when she could have honestly 
said that she had enjoyed it. In fact, in spite of Nick her time at 
Cambridge had been one of the happiest of her life. Break time 
was over.  It was time to see what else was in the junk room.
 

-- o -- o -- o --

Cathline had just walked back from the jetty, leaving a still 
squabbling Matthew and Kat there. The Jetski race had been 
bitterly fought and much to Matthew's chagrin Kat had 
triumphed in all six races. She wasn't unduly worried about them 
arguing. It was all very good natured, but those two did seem to 
take it especially seriously. She had made her way back to the 
house to get some more water. Apparently it was her turn to 
race Matthew next -- she would of course let him win as his ego 
had been bruised enough. John and Alex had taken the yacht 
back to Male to get some fresh supplies so they would be gone 
several hours. Cathline opened the door of the house and 
walked into the marble floored hallway. In the corner of her eye 
she detected movement from one of the upstairs walkways. A 
figure in a white blouse, reddish blue skirt and auburn hair had 
just shot into a spare room. 

'I wonder what Elizabeth is up to?' Cathline thought. She hadn't 
ever recalled seeing Elizabeth wearing such clothes. Normally 
Elizabeth was very fashion conscious and from what she'd just 
glimpsed her clothes were at least twenty years out of date. 
Cathline walked up the stairs and pushed open the spare room 
door. For a moment Cathline mistook the woman who had just 
whirled guiltily around for someone else, someone from her 
painful past. The moment after she realized who it really was, 
"Elizabeth what in hell are you doing skulking around like that? 
Whose clothes are they?"

"Hi Auntie Cathline. I'm just sorting thru some of Dr Bexley's old 
things." Elizabeth pointed to her new attire, "I guess I got a bit 
carried away." Elizabeth's face had instantly gone into the 
'innocent as a summers day' look that she'd developed over 
many years.

"I'll say you did. Why are you wearing her clothes? They don't suit 
you at all," Cathline commented. 

"I was trying to get inside her mind. To try and work a few things 
out for myself. If I'm to make any sense of all this." Elizabeth 
gestured to the contents of the room. "Then I need to go beyond 
just rummaging around at random. In understanding her I start 
to understand myself. Cathline, when I was away at Cambridge I 
discovered something horrible."

Cathline sat down on the floor, brushed her hair away from her 
face, and said ,"Which is?"

"That unless I break free of my fear of Dr Bexley then I'll never 
be able to love or trust anyone properly. I don't want that. Maybe 
I'm making too much of it but that comes from what supposedly 
went on all those years ago and what effect it had on the three 
of you."

Cathline picked up on the key word in that sentence, 
"Supposedly?"

"I have to keep an open mind on all things if my analysis is to be 
accurate," Elizabeth refused to be drawn any further. Revealing 
her plans to Cathline was the last thing she wanted to do. From 
now on Cathline, Kat, and Matthew were the 'enemy'. The switch 
in status was a logical one. She couldn't get inside the mind of 
her late mother unless she thought exactly like her, had the 
same prejudices as she did and viewed the world thru her eyes.

"I see. Is that why you wanted to look thru all her stuff?" Cathline 
asked.

Elizabeth nodded. "I need to free myself of HER. This is the only 
way'"

Cathline stood up and gave a brief nod. "Be careful. If you want 
to wear her stuff then fine but the second we detect that you're 
acting strangely this little experiment of yours is to stop, right?"

"Thanks Auntie Cathline," Elizabeth breathed a sigh of relief.

Cathline almost bolted out of the door. She ran almost full pelt 
towards the beach where Matthew and Kat were still in full flow.

"Cheated? How can I cheat when we swapped Jetskis twice?" Kat was 
saying.

"You two, "Cathline panted.

"What?" Kat turned to face Cathline. 

"It's started, "Cathline said solemnly.

"What has?" Matthew asked.

"I caught Elizabeth going thru Dr Bexley's old stuff,"

"So, she said she wanted to help," Matthew stated. "What's the 
problem?" 

"She was dressed in some of Dr Bexley's old clothes. Actually it 
was the outfit she wore when she first came to my house, but 
anyway she gave me some spiel about needing to find out more 
about HER so that she could find herself. She said she needed 
to get inside HER mind in order to free herself, " Cathline's voice 
had dropped to almost a whisper.

"What do we do? If we ban her she'll only go and do it anyway 
when she's back in Cambridge. If we leave her alone then we 
run the risk of losing her all together."  Matthew now saw 
the seriousness of the situation.

Kat thought for a few moments. Matthew had a point. "We let 
her go thru with it but keep a close eye on her. If we push her 
away now we might never get her back. At least this way we can 
keep it quiet."

"At what point do we inform the authorities? When she starts 
turning people into goo? When she builds her late mom's DNA 
system again? Or when she murders a boyfriend that decides to 
finish with her?" Cathline snapped.

"That's an overreaction, Cathline. There's no need for her to 
undergo the test just yet. She's growing up, she wants to know 
who she is and where she came from. That's a long way from 
killing people," Kat answered back.

"I'm with Kat on this one. This is our daughter for Christsakes. I 
was never happy about the arrangement as it was but it was the 
only way to let her live. Now are we going to send our daughter 
to something that could easily end up with her being committed 
for life just because she decides to play at being 'hell bitch' for a 
few days. Cathline, I know your role is to ensure that we stay on 
track, as the counterbalance, but this is too soon." Matthew's 
eyes showed a glint of tear. It couldn't be happening, could it?

"That's unfair Matthew. You know I love her like she was my 
own. But we have a higher duty to ensure the innocent are 
protected. You're right, it is too soon. I wish I'd never said what 
I'd said. It seemed so heartless and cruel. The whole deal is 
heartless and cruel. Let's just keep an eye on her and leave it at 
that."

"Thanks Cathline. I hated the arrangement too. This business of 'Should 
Elizabeth Stephens exhibit the same psychotic behavior as Dr 
Elizabeth Bexley then she is to be screened and tested for 
sociopath behavior. If the tests prove positive then she is 
to be committed to preserve the lives of those she would come 
in contact with.'" Kat's eyes were glistening with tears now. The 
thought of her beloved daughter shut away in some institution 
was almost too much to bear.  This threat had hung over their 
head for the past twenty years and now in spite of everything 
they had done it looked to be happening.

-- o -- o -- o --

Elizabeth breathed a sigh of relief. At least Cathline hadn't 
blown her top at her. She was under no illusions that her excuse 
had done anything but muddy the waters a little. Cathline and 
her parents were too smart not to know she was up to 
something. However, there was no way that they could know 
what that something was. Elizabeth considered the options for a 
few moments. She could put the whole thing off until she got 
back to Cambridge, but then she would lose access to all Dr 
Bexley's effects. Proceeding as planned would create too much 
suspicion, so there had to be some middle ground. In an instant 
it came to her, she would act as normal but gradually get into 
her Dr Bexley persona over a period of days. That way her 
parents would get used to her wearing her clothes for example 
and not get too worried.

After all, what had they to worry about? She wasn't about to go 
killing people and whatever. This was a simple simulation, a 
thought experiment. Elizabeth realized that she needed a way to 
easily switch in and out of her Dr Bexley 'mode'. So that in her 
mind she could flip between them and still preserve the integrity 
of both. She decided that giving her Dr Bexley mode a different 
name to herself would be the ideal way. She of course being 
herself would still be Elizabeth, that much was obvious, but what 
name could she give to the simulation?

She considered Lizzy, as that was suitably short and concise, 
but somehow it didn't seem to fit. In order to name her Dr Bexley 
mode properly she would need to choose a name that Dr Bexley 
had used. Elizabeth considered Nemesis, but she had no 
reason to revenge anyone, except maybe Nick. Hera was 
another one she had used but Elizabeth had no control over all 
living things. Elizabeth cast her mind back -- what was Dr Bexley's 
first and last alias? That was it, Deianeria! That was the perfect 
name for her new simulated persona.  From now on when she 
was being Dr Bexley she would refer to herself as Deianeria, and 
when -- as she would be most of the time -- she was being herself 
she would still be Elizabeth.

Elizabeth wondered if this dual name thing could be regarded as 
a mild form of multiple personality disorder, but dismissed the 
idea. Deianeria wasn't a separate person, she was simply the 
name of a simulation; in just the same way someone names 
a ship or aircraft. Elizabeth formulated the rest of her plan. She 
would be Deianeria for the rest of the day but would continue to 
wear the same clothes. It would take that long for the 
Olanzapine to wear off anyway. Tomorrow after her swim she 
would take some new clothes from the chest, and again 
Deianeria would have to stay dormant. As the week progressed 
she would become Deianeria for small amounts of time, and thus 
not alert her parents and Cathline to what was really going on.

Elizabeth stood up, straightened her skirt, and after taking a last 
look around for today stepped out of the room. In the distance 
she heard Chopin being played from one of the side rooms. 
Alex was practicing again. Elizabeth had to admit that Alex was 
pretty good. Actually, Elizabeth thought Alex was good at a lot of 
things. It was interesting to compare their relative strengths. 
Whereas she was tidy, meticulous both in thought and deed, 
Alex seemed to live his life as he went along. Maybe that's why 
they needled each other so much. They were opposites pure 
and simple. Elizabeth wasn't that interested in art or literature, 
preferring the black and white, true or false that her meticulous 
mind easily grasped to Alex's 'go with the flow' artistic flair. 

She decided to go downstairs and see what Alex was up to -- she 
felt up to some verbal sparring. It was something she liked about 
him. But she couldn't help think that she was getting a little tired 
of this constant oneupmanship between the two of them.

Alex paused playing as Elizabeth walked into the room, "Hi 
Kiddo. That's not quite your look is it?" 

Elizabeth looked down at her new outfit, "Oh, what? This? Thought 
I'd play at being Dr Bexley for a while." How would Alex react? 
Would he take this as a hint as to her intentions? 

"Whatever, " Alex said, ignoring Elizabeth's comment. 

"You've got better since I was last here, " Elizabeth commented

Alex pretended to fall off the Piano stool in shock, "You. You just 
gave me a compliment! Where's my PDA! I need to note this 
down"

"I said better, not good, "Elizabeth said with a smile. This was 
more like it.

"Ok then, Miss Priss, you try, " Alex challenged. He knew full well 
that Elizabeth wasn't anywhere near as musical as he was. In 
fact his whole ploy depended on it.

Much to Alex's surprise Elizabeth agreed, "Ok, fine. I'll do you 
a deal. You do my gene sequencing for me as well as I play the 
piano, and I'll buy you dinner."

'She took the bait' Alex thought and held his hand out in order to 
sign the deal, "And if you lose?"

Elizabeth had a thought, "Then you have go on a date with 
Angela when you're next in Cambridge"

"Angela's cute but not as much as you are," Alex said with a 
smile.

Elizabeth was a little puzzled. Was Alex making a move on her, 
ridiculous!  "Yes but she's available, I'm not!"

Alex looked around, "I don't see any boyfriends here."

"I didn't say I had a boyfriend," Elizabeth snapped. The subject 
of boyfriends brought the pain of Nick's betrayal to the fore. 

"Girlfriend? Now that'd be a scoop, " Alex raised an eyebrow.

Elizabeth gave Alex an 'as if' glare "Look, in the unlikely event I 
lose I'll take you out -- you lose you go out with Angela."

Alex reached out to shake her hand. "One more thing?"

"And that is?" Elizabeth demanded

"You take me out in Male! You'll double cross me or something if 
I wait." 

"Fine! Now where's that spare stool?" Elizabeth said, and shook 
on the deal.

A few minutes later Alex was laughing his head off. "Liz, you play 
like a toddler who thinks a piano is a trampoline. Look, follow my 
fingers."

Elizabeth was in a huff. She hated being laughed at. "Look, just 
give me time. I can do anything I put my mind to."

Alex was still smiling. It was working out just the way he wanted 
it to. Elizabeth could do with some humility. "That wasn't the 
deal, was it? How much time do you want Kiddo? You've either 
got it or you haven't. And Kiddo you ain't even close."

"Hmmph!" Elizabeth hated being shown up, especially in front of 
Alex. Why had she gone along with this stupid bet? 

Alex stood up behind Elizabeth and took hold of her hands. He 
started to show her the finger movements in the correct pattern.

"It's ok I can do it now, " Elizabeth stated. She had memorized 
the finger movements of this particular piece and was now 
confident she could play it.

"Ok go then, " Alex said.

"Don't worry I will," Elizabeth stated. She was sure she had the 
finger movements memorized. 

"One more thing? Let's change to some Rackmaninoff," Alex 
said with a grin and flipped the page over.

"Hey," Elizabeth protested.

"I never said you had to play the same piece did I?" Alex said, 
his eyes alight with mischief.

Elizabeth gave him one of those looks that normally would wilt 
the most stern of hearts. Alex however had endured years of 
them and it now had the opposite effect. 

Now Elizabeth was really cross. Nothing she did or said seemed 
to faze Alex in the slightest. She never seemed to come out 
on top of these tussles, and she could never work out why. 
"That's enough! My turn now. You only have one chance at this. 
Remember, if I win you go out with Angela next semester. You 
have the following sequences available. Which is incorrect? 
CCTGAATAAGAGCAGAGCAAATTCCCTAAAGGGAA and
CCTGAATAAGAGCAGAGCACATTCCCTAAAGTGAA."  There, that'll teach him!

"Umm, What was that again?" Alex floundered.

Elizabeth gave Alex and evil looking grin. "You also have to tell 
me why."

Alex furrowed his brow. Knowing Elizabeth, it wouldn't be easy. It 
would be a trick question. But then again she would know he 
knew that. Oh well, dinner with Angela wouldn't be that bad. 

Alex took a wild guess, "Both of them. You made them up"

Elizabeth shot Alex a look! "I'll meet you at eight," and stomped 
out. She was now well and truly pissed off at this constant one 
up man ship even though she had participated in it.

Alex wore a grin a mile wide. It had worked out perfectly. 

-- o -- o -- o --

Elizabeth thought about dressing up as dowdy as she could for 
her dinner with Alex. Her parents and Cathline had reacted with 
typical amusement at the result of the bet, so they were 
no help at all. The only help her dad had given her was to 
charter a helicopter to fly them over to Male. It seemed as 
though Alex had planned the whole deal out. They would fly to 
Male, and get a boat to Rangali before dining at the Hilton resort 
hotel. Elizabeth really wanted to go in her jeans and T-Shirt but then
she would look the fool, not Alex. Then she had another idea. 
She would go and see what Dr Bexley had in the way of 
evening wear. 

As nonchalantly as she could muster Elizabeth walked into the 
spare room and started to search thru Dr Bexley's clothes. Like 
herself, Dr Bexley liked to dress well, and surprisingly she liked a 
lot of what she saw. There was no need to involve Deianeria in 
the decision. After much searching she found an exquisite black 
dress. It was strapless in design, and showed more flesh than 
Elizabeth normally wanted, as the entire back was exposed as 
well as almost all of the right leg, and it also had a plunging 
neckline. Quickly stripping off her existing clothes, she put the 
dress on, noting with satisfaction that it went in and out in all the 
right places. It still needed a little something, something that 
would guarantee she'd get all the attention and not Alex. That 
was it! Garter belt. The cut of the dress meant that when she 
walked she would expose the tops of her garters as well as the 
straps. It would give her a 'slut' look, and normally she'd shy 
away from such a look, but this wasn't a date, this was war!

Elizabeth couldn't find any of Dr Bexley's garters, so she scurried 
back into her room and quickly put her own on. As expected, she 
knew the effect her look would have on every male in the 
room would be devastating. She knew Deianeria would be 
pleased too, the perfect predator. She fished up her makeup kit 
and proceeded to use it, not too much but enough to bring out 
her high cheek bones and blue-gray eyes.

At seven fifty there was a knock on the door. Elizabeth opened it 
expecting to see Alex but was surprised to see Bob, the local 
chopper pilot. Her surprise turned to sadistic pleasure when she 
saw his eyes widen and he tried his hardest not to eye up his 
customer.

"Alex will meet us in Male," he managed to mumble.

"Ok let's go," Elizabeth said and followed Bob downstairs.

Matthew was sitting in the library when he saw Elizabeth waft 
past. "My god, " he whispered to himself. Elizabeth had 
somehow transformed herself into the very image of Dr Bexley 
the night she'd proposed to him. It was an unnerving sight, as if 
a ghost had just walked past. Matthew decided to say nothing. 
Elizabeth had been acting perfectly normal all day and had even 
fallen for Alex's little bet. Apart from dressing up there was 
nothing to be concerned about. Matthew went back to his 
reading. Alex sure was a lucky guy.

Elizabeth landed about an hour later. The chopper flight had 
been short and boring. She had sat in the seats at the rear and 
so didn't have the pleasure of seeing Bob distracted from his 
job. A cab was waiting for her as she stepped out of the 
chopper. "It's ok miss, Mr Richards will be waiting for you by the 
quayside."

Elizabeth gave a nod. Alex had certainly planned this all out. 
Ten minutes later Elizabeth saw Alex leaning against a street 
lamp. On hearing the cab draw up he gave a wide grin and 
moved to open Elizabeth's door. Elizabeth was about to 
complain but decided that if Alex wanted to be the gentleman 
then she would let him. It would make a nice change from 
playing the clown.

"Why thank you, " Elizabeth said as Alex opened the door. She 
noted with immense satisfaction that Alex's eyes were wide 
open and that he had cast an appreciative glance up her 
exposed leg. Now the hunter becomes the prey, Elizabeth 
thought. 

Elizabeth suddenly noticed that Alex was dressed in his casual 
clothes "You're a little underdressed aren't you?"

"Not for what I have in mind. I knew you'd try and out do me and 
you did. You look absolutely stunning. I don't think I've ever 
seen you look so good but for what I have planned you'll have to 
change."

Elizabeth took the compliment in her stride, she knew she 
looked good. However she did see herself as being out 
maneuvered yet again by Alex. Why didn't she think to ask what 
she should wear! "This is all I have on," She complained.

Alex pointed to a small bag on the floor. I knew you'd do 
something like this. That's why I brought you a change of 
clothes. I'd hate for you to ruin that outfit."

Elizabeth snatched the bag off the floor and looked around for a 
place in which to change. She spotted a small cafe a hundred 
meters along the quayside and stomped inside. Once again 
Alex had managed to make a fool of her!

A few minutes later she had changed into her old pair of skirt-
pants and blue T-shirt and had stuffed the dress inside the bag. 
Walking back to Alex she had cooled down a little. Of course 
Alex would try and do something a little different, so she should 
have asked rather than get pissed at him. Would Deianeria get 
pissed at him? Probably not. She would wait until the right 
moment and then get him. Elizabeth decided that's what she 
would do. "That any better?" She asked.

Alex gave a nod, "Perfect. Now we can get in the boat. We still 
have a trip to Rangali to make."

Alex helped Elizabeth into the motor launch before getting in 
himself. With a whir the motor launch's electric engines started 
and they were underway. 

Darkness had fallen suddenly and with the turquoise sea now 
an eerie black Elizabeth had not much to look at. The garish 
neon front of Male quayside had started to diminish. She turned 
to Alex who was still looking at the array of neon lights falling 
slowly away from them. Elizabeth sat crossed legged and just 
staring straight ahead. In spite of letting Alex off a little for the 
dress code mix up she was still annoyed to have been tricked 
into coming out with him in the first place. She was however 
honor bound to abide by the terms of the bet. "You can't get into 
the Hilton dressed like this!" Elizabeth stated to Alex.

Alex shook his head. "You'll see soon enough."

Elizabeth was getting a little tired of this mystery tour game Alex 
was playing but still couldn't help but be intrigued. Part of her 
was enjoying it a great deal. Maybe she'd misjudged Alex. Not 
wanting to give Alex any more entertainment or spoil the boat trip 
she sat and looked out into the black ocean. 

"Mysterious isn't it? I mean anything could be down there and 
probably is, "Alex commented.

Elizabeth didn't reply. She knew very well what was down there. 
Fish. She did however cast a glance in Alex's direction. 

"Yunno Elizabeth, " Alex continued

Elizabeth didn't reply. She was still wondering what Alex had 
planned for her.

"I'm not always out to show you up," Alex went on. If he was to 
get any enjoyment out of this evening he had to offer Elizabeth 
an olive branch.

'Yeah, right' Elizabeth thought but said nothing.

"Sometimes I am and that's because I just don't know how to 
take you. How about we start again? Forget I tricked you into 
coming and let's just enjoy the evening. Before we know it the 
vacation will be over and we won't see each other again for a 
few months,"

'Suits me' Elizabeth thought and nearly said it. But why was Alex 
telling her all this? Why did he want to make peace with her? 
Instead she shifted her gaze to the flickers of phosphorescent 
light from the plankton that flowed from either side of the boat. 

Alex tried again. He was tempted to make some sarcastic 
comment but thought better of it "How do I handle you 
Elizabeth? Every time I see you I am in awe of you. I guess my 
teasing is my defense mechanism for me being tongue tied."

Elizabeth turned to look at Alex. Alex shy? Never! In awe of her? 
No way. She couldn't resist answering this time "Alex I'm getting 
fed up of me answering you and then you're twisting it around 
and making me look foolish."

Alex gave Elizabeth a serious look, "That's what I'm trying to 
say. We've been at each other throats, in a playful fashion since 
we were little. I'm getting tired of pretending we're both twelve 
but I don't know how else to deal with you." 

Did Alex really mean this or was it some ploy? Elizabeth 
decided to bite once more. If it meant the end of their constant 
sparring then anything was welcome. "Then treat me as anyone 
else not your kid sister."

Alex nodded, "I know it's just that..."

"Just what?" Elizabeth demanded

"Tell you later, " Alex said softly.

"I knew you'd do this too me! You always try and drag things out 
for your own personal little games!" Elizabeth snapped.

"Elizabeth, It's not like that at all. I promise. Look we're nearly 
docked. It's time for your surprise," Alex said softly.

Elizabeth noted the hurt look on Alex's face but couldn't be sure 
if it was genuine or not. Anyway, as Alex said the boat was 
about to dock. 

Alex was the first off and took Elizabeth's hand to help her off 
the boat. Strangely for Alex she did so without complaint. After 
being passed their bags Alex pointed to the Hilton hotel, which 
was a small walk away, "That's where we're going."

"If you say so, but they'll not let us in, "Elizabeth stated.

"Now the old Alex would now place a bet and trip you up, but the 
new one is just going to say 'trust me'," Alex said with a smile.

They walked in silence for a few minutes until they reached the 
elaborate entrance of the Hilton Hotel. It was split between the 
two islands of Rangali and Ranglifinolhu and much of it was now 
sited underwater. Only the tops of a few luxury lodges peeked 
above the reef surrounding the islands. Elizabeth went to walk 
inside the entrance but Alex pulled her to one side, "Not that 
way!"

"Alex where are we going?" Elizabeth demanded.

"Round the side entrance, come on," Alex gave Elizabeth a 
mischievous look and ran off.

Elizabeth raced after him, determined to see what harebrained 
scheme Alex had cooked up. She followed Alex down a dark 
side alley until the reached a door marked 'staff entrance'. Alex 
indicated that they should go in there.

"Why are we here?" Elizabeth hissed.

"Shh," Alex said and rapped a sharp tattoo on the door.

A few seconds later and a small Hispanic man with short dark 
cropped hair and wearing a white overall opened the door. On 
seeing Alex he broke out into a wide smile, "Alex Hi. It's great to 
see you again. It's been a while."

"Obrigado, Manuel. Faz muito tempo desde a nossa
pescaria," Alex said in fluent Portuguese 

Manuel gave an even wider smile, "Thank you we must try to 
meet up more often. This face I know. Elizabeth right?" he said 
turning his smile to Elizabeth.

Elizabeth was mystified. Who were these people and how did 
Alex know them? "Alex please introduce me."

"Oh I'm sorry. Manuel is one of the senior chefs here. I met him 
last year while I was fishing. Anyway we're here to help him," 
Alex stated.

"Help him?" Elizabeth queried.

"Yep," Alex said with a smile.

"Not to eat?" Elizabeth was starving. What in hell was Alex 
playing at?

"Not yet. First of all we have to earn it,"

Elizabeth grabbed hold of Alex's arm and pulled him outside, 
"What do you mean 'earn it'?" she hissed. 

"No I didn't forget my wallet nor is mom broke. How many five 
star restaurants have you eaten at?"

"More than I can remember," Elizabeth admitted. 

"How many restaurants have you worked at?" Alex asked with a 
smile.

Elizabeth said "None."

"If I'd have taken you out for a meal here then it wouldn't be 
unique would it? You'd have it labeled as 'just another meal at a 
top class hotel, boring!' This way we get to eat and have fun 
beforehand doing something you've not done before." 

"I guess," Elizabeth confessed. She must admit part of her was 
finding all this good food a little dull. How did Alex know? So 
that's why he'd dressed in casual clothes. They were going to 
work!

Alex poked his head around the corner of the door and called 
"Manuel, para começar, o que você tem para nós fazermos?"

Manuel's beaming face appeared around the door "What have I 
got for you to do? Well Alex, You take the dirty plates and after 
putting the remains in the trash you give them to Elizabeth for 
washing."

"We're going to wash up?" Elizabeth stated.

Alex nodded, "Looks like it. Manuel will show us."

Elizabeth sighed 'oh well in for a penny'

Manuel led them inside to a vast kitchen area. Every surface 
was immaculate and all around them the staff moved as though 
in some kind of military operation. Elizabeth was impressed by 
the efficiency of it. Manuel led them thru to a large container full 
of boiling water. 

Manuel showed Elizabeth. "We don't use dishwashers here as 
they ruin the plates and they are much slower than this method. 
Just put the plates in this rack here and drop them in. Careful, 
this water is literally boiling. Pull the covers over like this, " 
Manuel pulled a large plastic cover over the container and 
locked it in place with five clips.

"Got it," Elizabeth said. This was a really demanding job she 
thought sarcastically.

Manuel then pointed to a dial on the side of the container. "Turn 
this three clicks and count to thirty. Now this is the careful bit. 
Unclip the cover and gently pull the Racks out. Get Alex to help 
you or you'll scald yourself. Since the water is superheated the 
plates will be dry almost as soon as they come out. There we go, 
that's it."

"Ok what's Alex's job?" Elizabeth asked.

"I told you. He scrapes off all the remains of the food and gives 
the plates to you," Manuel said with a smile.

"Is that all?" Elizabeth asked. Once again Alex had got off 
lightly.

"Alex goes fishing with me, so I give him the easy job," Manuel 
grinned again at Elizabeth.

This was not turning out as Elizabeth expected at all. But she 
had resigned herself to doing it. "Come on Alex, I need those 
plates," she demanded. If Alex had the easy job, Elizabeth 
decided she was going to do her best to make sure he did it 
faster than he would like to.

"Already there," Alex smiled handing Elizabeth a stack of ten 
plates. 

Elizabeth soon got the hang of it. Actually it took her two goes to 
perfect the technique and soon she and Alex were on autopilot. 
Half an hour went by as if it was only a minute.

"You know what?" Alex asked handing Elizabeth a particularly 
dirty plate.

"What?" Elizabeth had found the last half hour strangely 
relaxing. She had nothing to do per se and so her mind had 
relaxed. Thoughts of Deianeria had been lost in the routine of 
grab, stack, dunk and unpack. 

"When asked to describe relativity Albert Einstein once said that 
if you were sitting on a hot stove two minutes seemed like two 
hours but when you were with a beautiful girl two hours seemed 
like two minutes. I just want you to know that this seems like two 
hours!" Alex's eyes were gleaming with mischief. 

Elizabeth couldn't help but smile inside. She was still holding the 
drying up towel in her hand and gave Alex a playful flick with it.
"You!" 

"Better hurry up -- we've only got half an hour left," Alex stated 
and handed Elizabeth some more plates and bowls.

"Til what?" Elizabeth said. Much to her amazement she was 
really enjoying herself. Once she'd got over the fact that it was 
Alex she was with she found herself enjoying his company. 

"Til we eat of course. I promised you a meal didn't I?"

"I'm starving. Hand me those plates and no more talking," 
Elizabeth ordered.

"Yes Ma'am, " Alex gave a salute.

Half an hour later Manuel came and inspected their work. He 
gave a broad smile and nodded his approval. "Alex sua 
presença é pedido na praia"

"Thank you Manuel." Alex said and fished inside his pocket and 
removed a blindfold.

"What's that for?" Elizabeth demanded.

"You. Now put this on. I'll lead you to where we need to go, 
"Alex said handing the blindfold to Elizabeth.

"You're not going to make me walk into a swimming pool are 
you?" Elizabeth stated. Things got more and more mysterious.

"No. Here let me help," Alex said placing the blindfold over 
Elizabeth's eyes. Elizabeth instinctively went to pull it off. She 
hated being out of control. She felt Alex's strong hand take hers 
and she decided to let him play his little game with her. 

Still holding Elizabeth by the hand Alex let her down the street 
and back onto the quayside. For her part Elizabeth was 
expecting to fall into a swimming pool, be left blindfolded in the 
middle of the street or some other such humiliating scenario. 
She had decided to give Alex a chance, so it was now down to 
him to prove or disprove the trust she'd placed in him.

Alex knew exactly where her was taking Elizabeth. "Wait here 
and don't move." He instructed Elizabeth.

Not having any choice except by ruining the game, Elizabeth 
stayed still hardly wanting to breathe. To her surprise she found 
the constant suspense and surprise exhilarating. She'd hadn't 
had that many surprises for a long while, and the feeling of being 
out of control of one's destiny and future was an intoxicating 
one. Deianeria would disapprove of course but she had been 
put aside for a few days. She felt Alex's hands lift her up around her 
waist as though she was made of paper. She hadn't realized 
how strong he was before. She felt a slight swaying motion as 
Alex put her down. So Alex had put her on a boat!

"Why are we on a boat?" She asked.

"Because that is where we need to be," Alex answered 
cryptically.

"Ok you win," Elizabeth admitted. She was by now totally 
mystified and enthralled by Alex's little games.

Elizabeth had no idea how long they were on the boat but 
she guessed it would have been about twenty minutes. Alex had 
insisted on her keeping her blindfold on, and by now Elizabeth 
didn't really mind. She was now sure that Alex wasn't going to 
trick her. She felt a slight bump as the boat docked 
somewhere. It couldn't be that far away from where she'd 
started off. It would be just like Alex to make her go in circles for 
a while and then they'd arrive back where they started. She 
hadn't detected any changes of course, however. So where were 
they?

"Elizabeth, hold still," Alex said and Elizabeth felt herself being 
lifted up once more by Alex. She was now completely at his 
mercy and somehow it had a releasing effect on her. She felt 
herself being placed onto a quay and told to stay there.

A few seconds later she felt Alex grab her hand once more and 
gingerly she started to be led by him. All she could hear was the 
wash of the water against dockside wooden beams and then the 
wash of water on the ocean shore. So she wasn't on a resort 
island then? She would have heard music by now if she were. 
Now what non resort island was within twenty minutes of 
Rangali? In her mind's eye a map of all 1,195 islands that make 
up the Maldives appeared. She traced all possible routes from 
Ranagli and drew a circle representing a twenty minute journey 
time around it. Only one place stood out, Hukurudhoo island.

"Alex, I know where we are!" She whispered.

"I thought you might. That photographic memory must be useful 
sometimes," Alex smiled. He was within twenty feet of where he 
needed to be.

"We're on Hukurudhoo," Elizabeth stated triumphantly.

"Wait," Alex commanded. Elizabeth did so.

Elizabeth felt Alex reach around the back of her head and 
remove the blindfold. It took a few moments for her eyes to 
adjust to the difference in light, and after the blurs had focussed 
she looked around.

In front of her was a dining table. By the looks of it, it had come 
from a five star restaurant as it was ornately laid out with what 
looked like a silk table cloth. Standing on two tall stands was two 
flaming torches. The firelight cast flickering red, yellow and white 
light all around the area and it spread all the way to the ocean 
just a few feet away. Sitting beside the table were several large 
plastic boxes and to one side in a bucket was a bottle of 
champagne. On the table were two wine glasses, and on one of 
the chairs a large bouquet of exquisite orchids.

"Alex, what is this?" Elizabeth asked. 

"Dinner. You like it?" Alex said with a smile. He knew she did! 

"It's, it's...," Elizabeth started. She'd never dreamed that Alex could 
come up with something this inventive, this surprising. She had 
misjudged him for a long time. There was now, clearly, much 
she didn't know about him. 

"Come on, I don't know about you, but I'm starving. Here let me," 
Alex said and showed Elizabeth to her seat.

Elizabeth picked up the orchids and gave them a sniff. Their 
fragrance assaulted her senses. The smell was like nothing she 
had imagined. It had flavors of the orient, the amazon and lofty 
alpine peaks. It was, she decided, a world map of scent and the 
most incredible array of flowers and colors she had ever seen. 
"Alex, this is incredible. It must have cost.."

Alex sat down on the opposite end of the table and looked 
Elizabeth in the eye. "Doesn't matter. This is OUR evening. Now 
the small blue plastic box contains our starters. I took the liberty 
of ordering for you. It's hard to get the staff this far out."

Elizabeth smiled, "So we are on Hukurudhoo?" She passed Alex 
the blue box.

"Yep. I never could keep anything from you for very long, could 
I?" Alex said as he reached down and retrieved two plates from 
a red box by his feet. He gingerly put them down on the table. 
"Good they're still hot."

Elizabeth noted the Hilton hotel's logo on the sides of the china 
plates. So Alex had got the stuff from the Hilton. "It all fits," she 
stated.

"What does," Alex said, spooning some kind of seafood platter 
onto Elizabeth's plate.

"The reason why we had to work for our dinner. Manuel needed 
two people to cover for him while he sent two of his guys out to 
do all this." Elizabeth gestured to her exotic surroundings.

"Right again. He'd be in real trouble if he suddenly went two 
people down on a shift. Therefore we had to fill in while they 
went off and did all this. Besides, it adds a little more spice to 
evening."

"Thank you Alex. I don't know what to say. It's wonderful," 
Elizabeth admitted.

Alex finished serving up the starters and poured two glasses of 
champagne He gave one to Elizabeth and kept hold of the 
other, "Thank you. It's taken me ages to plan out. Here's to us."
With a clink they tapped glasses.

"Elizabeth?" Alex asked.

"Yes. This seafood is fantastic," Elizabeth commented.

"You've not been yourself since you arrived back home from Cambridge.
You've been on edge all the time you've been here. What's up?" 
Alex said, the concern showing in his eyes.

"It's just a project I have going on that's all." Elizabeth didn't 
particularly want to ruin the mood by talking about that.

"It's more than a project to you, isn't it? You seem to forget I 
know you more than you do yourself. We grew up together. I 
know when something's up. I think I know what it is," Alex said, 
putting his knife and fork down. 

"What is it?" Elizabeth said a little defensively. 

"Judging by you going around wearing Elizabeth Bexley's old 
wardrobe, I think you're doing an in depth study into the Fury. 
Trust me it's a pointless exercise."

Elizabeth's face had turned to stone. There was no point in 
denying it. How did he know? "It's not a pointless exercise. Don't 
you want to know the truth?"

Alex shook his head, "Why bother? What's done is done. It all 
went on over twenty years ago. We can't change what occurred 
all that time ago but we can -- and we all need to -- move on from it. 
Mom, Matthew, and Kat, and you too."

"Even if what we've been told is a lie?" Elizabeth stated.

Alex studied Elizabeth's face. Her blue-gray eyes were afire. 
This was important to her! "It's not a lie, Elizabeth.  Sure, the 
government has classified everything to do with it, and that's 
helped fuel the lie that my mom and yours made this all up, but 
what about all those people who were affected by Bexley? You 
can't create a conspiracy with that many people in it. Sooner or 
later someone blabs and it's all out in the open. All this 
investigation is doing is screwing with your mind."

Elizabeth was now feeling a little angry. Deianeria wasn't 
screwing with her mind. Deianeria was an essential part of her 
getting to know herself. Alex couldn't know the desperation she 
felt, and had felt for some time, about her fears for the future. She 
was right about not telling Alex about Deianeria after all. 
"Thanks for your concern Alex.  But it's not you who looks like 
HER is it? It's not you who's had those cult bastards after you. 
I need to know all about this. It's not for them, it's for 
me. I need to know who I am."

Alex nodded, "I know. You remember when I tried to find my 
father's body a while back? Mom told me he had been killed 
during the guild war after screwing her when she was in 
Osman's harem. She never even knew him, didn't even know 
she was pregnant until much later on, and she raised me as best 
as she could. I know she's been lonely ever since John was 
killed, and in spite of the rumors I know she's not had any one 
else. She doesn't want anyone else! I know what it's like not to 
know who you really are. At least you know where you came 
from. I gave up on trying to find him, I spoke to everyone who 
was there at the time, Mom, Tina, Scott and everybody, but they 
had no idea and could offer no leads. So I dropped it, figuring 
that what mattered was that my family loved me and that who I 
am is only up to one person, me."

Elizabeth felt a little guilty about being angry at Alex, "I 
remember your search. You ended up looking more sad and 
depressed than I can ever remember."

Alex nodded, "It took me months to get over that 
disappointment. Listen, all that awaits you if you persist with this 
project of yours is pain and fire. I'll leave it at that. You make 
your own mind up. You always did and always will. It's one of 
the things I like about you."

Elizabeth had to concede Alex made a valid point, but her pride 
was at stake. She had to prove the Bexley cult wrong for herself 
and for the world. All that she held dear was in danger until she 
did. She decided to let it drop. It would ruin the evening if she 
carried on as she did. "You'd better hurry up. I've finished my 
starters," 

"Ok, will do," Alex said and started to eat once more.

Alex had only half eaten his starters so Elizabeth took a further 
look around. It wasn't cold outside and a gentle sea breeze just 
kept things from being too humid. The gentle lapping sound of 
the water relaxed her and she found the setting more idyllic than 
even her parents island. After all that was just home, this was 
close to heaven! Elizabeth studied Alex's face. She hadn't really 
noticed it but he had inherited Cathline's look of integrity and 
nobility. Of course his jet black hair and dark complexion came 
from his unknown father and his deep brown eyes gleamed with 
sharp intelligence, wit, and compassion. 

"Time for the main course, pass me the large yellow box please, 
"Alex asked.

Elizabeth did so, boy was it heavy, "What are we eating 
Elephant?"

"Nope just Manuel's special duck,"

Elizabeth cast her mind back to the conversation on the boat 
going over from Male. "You said you were in awe of me? Why"

Alex waited until he'd placed a perfectly cooked duck breast on 
Elizabeth's plate, "Because I am. You are the most remarkable 
woman I have ever met. You are just simply devastating, in 
intelligence, beauty, and heart. That's why I get so tongue tied 
around you and resort to teasing. I have no idea how to handle 
you."

"You trying to seduce me?" Elizabeth asked with an incredulous 
look on her face. Alex and herself, what a joke!

Alex gave one of his beaming smiles, "What I was trying to say 
to you on the boat was that in spite of everything we've done to 
each other, the jokes, teasing and fighting, in spite of the big 
brother act, I can't help but admit to you I'm falling in love with 
you. I didn't plan it this way. It just happened."

Elizabeth dropped her fork in shock. Alex in love with her? How 
come? "Alex this is the most cruel joke you've played on me. 
How dare you!" she snapped and rose from the table.

Alex stood up and grabbed hold of her arm, "It's no joke 
Elizabeth. I realized while you were away that I missed you. 
That I wasn't able to be the person I wanted to be while you 
weren't around. Elizabeth. I love you. There I said it!"

"I don't know what to say," Elizabeth said. How had it come to 
this? 

"Neither do I. Not any more. It's taken me years to work out 
what it was that made me so awkward around you. Please tell 
me how you feel," Alex said.

"Feel? I feel confused. How can you fall in love with me Alex? I 
thought you hated my guts. We're opposites in everything we 
say and everything we do." Elizabeth walked away from the 
table. She needed to think for a while.

Alex walked after her and soon caught up. "Elizabeth do I have 
any chance with you? Please I need to know."

"Alex I just don't know. I came on this date thinking you were 
setting me up and now you tell me you're falling for me." 
Elizabeth turned to face Alex. She looked up into his eyes. They 
were full of expectation, fear and concern. He was telling the 
truth. 

"I'm sorry. I needed to get you on your own so I could tell you. I 
just had to, otherwise I'd live my life out in 'what ifs' and maybes. 
You want to find out who you are, let's both find out who we are 
together." Alex's voice was now a whisper.

To her surprise Elizabeth didn't move away. She didn't know the 
reason, just that to move away would be wrong. It was as if 
some external force had paralyzed her legs. Her heart was 
telling her to stay, and in matters of the head and heart the heart 
always wins. 

Alex took hold of her and drew her close. To his surprise he felt 
no resistance and he moved in and kissed Elizabeth on her lips. 
Elizabeth pulled away. "How dare you!" she snapped, and 
slapped him full around the face.

Alex turned to leave, his heart in tatters.

"No you don't! come here!" Elizabeth roared and pulled Alex 
back towards her. Then much to Alex's astonishment Elizabeth 
kissed him back. 

Elizabeth felt as though a fire within her had been lit. Her mind 
told her that kissing Alex was an insane thing to do. That no way 
this would work out and the only reward would be pain, and loss 
of a good friend. Her heart told her that something within them 
had just connected. It was as if two souls had just joined for the 
first time after centuries of searching. She felt Alex pull her 
closer to him and his strong arm enveloped her waist. Every kiss 
they shared made her feel more alive than she ever had been 
before. 

Instinctively she unbuttoned his shirt and ran her hand over 
Alex's strong, muscular chest. Alex was kissing her neck and 
gently kissing her ears. Tingles ran down her spine -- this was so 
right! How had she been so blind?

She managed to pull away for a second, "Alex we need to talk?"

Alex stopped kissing Elizabeth's neck and nodded his 
agreement, "I'm sorry. This just felt so right."

Elizabeth put her finger to his lips, "Don't be sorry, it IS right. I 
never realized it before but I feel as though we just connected. 
Like this was supposed to happen."

Alex took hold of Elizabeth's hand and drew his arm around her. 
"I know. Scary isn't it? Where do we go from here?"

Elizabeth put her arm around Alex's waist. She felt safe and 
secure there. It was an unfamiliar but welcome feeling. "One 
step at a time. Starting with dinner."

Alex turned and gave her a peck on the cheek, "Always the 
practical one."

A few minutes later they had both sat down and were playing 
footsie under the table. Alex felt a tingle every time Elizabeth ran 
her foot around his. He couldn't believe that this incredible 
woman wanted to be with him. His heart was soaring and he 
had never been so happy or content. It was as if his entire life 
had led up to that kiss on the beach. Whatever tomorrow 
brought he would always have that kiss.

The young couple on the beach spent the rest of the main 
course looking into each other's eyes, holding hands at the table 
and making small talk. Whatever or whoever had brought their 
souls, their lives and their love together was establishing a 
foothold and wasn't about to let go.

"Let's take a walk. Desert can wait, " Elizabeth said.

Alex nodded "Cherish the love, cherish the life."

"Sorry?" Elizabeth queried

"Old song. Sorry, " Alex admitted. What had made him say such 
a stupid jerky thing?

Elizabeth wasn't into songs but Deianeria was. "How'd it go?"

Alex shrugged "I don't really remember. Sorry. I was just 
thinking that no matter what happens tomorrow or the next day 
I'll always cherish this night."

Elizabeth drew Alex along side her and rested her head on his 
broad shoulders, "Me too," she whispered.

"Look I can see a ship in the distance. Wonder where's it 
going?" Alex pointed to a row of lights near the horizon.

"Who knows?" Elizabeth shrugged.

"Just think. Out there," Alex pointed to the horizon, "There are 
people meeting their someone for the first time. Millions and 
millions of somebody's looking for their own someone."

"I guess so. I hadn't thought of it in that way," Elizabeth 
admitted. 

Alex gave a laugh and drew Elizabeth in for another kiss. She 
responded then she broke away. "One step at a time."

Alex smiled, "Agreed. Where do we go from here, after desert 
that is? I think we just see how it goes. Let's enjoy now and 
worry about the kids later?"

"Kids? You expect me to have your kids? I've only starting to get 
used to idea of you as boyfriend material," Elizabeth smiled

Alex checked his watch "Later. Look it's getting late. We'll take 
desert back with us."
 

"Ok. Alex?"

"Yes?"

Elizabeth looked Alex in the eyes "Tonight has been wonderful. I 
never dreamed it would work out like this or I would feel the way 
I feel. I guess, deep down somewhere I liked you too. It needed 
your courage to make me realize that. Maybe I was afraid to 
look beyond my teasing and 'oneupmanship' to see what was 
beneath."

"What is beneath?" Alex asked

Elizabeth pulled Alex in for another kiss. "Hope."

 -- o -- o -- o --

Elizabeth woke up the next day feeling giddy and elated. Last 
evening was surreal. Never in her wildest dreams had she 
imagined that she would be dating Alex. Only a day ago the 
mere thought would have either outraged her or reduced her to 
fits of laughter. Now, only few hours after that first kiss the 
thought no longer seemed repulsive or funny. In fact it seemed 
quite the opposite. One thing concerned her about her new 
relationship with Alex. Where did it leave Deianeria?

Elizabeth thought back to Alex's comments on her quest. He 
was right to be concerned for her but he was very wrong about it 
only producing hurt and pain. She had to know. This was more 
than a scientific experiment, it was her only way to free herself 
from the past. She was grateful to James, the cult leader, as she 
would not have dared go where she was going without his 
challenge: 'Prove me wrong!'

Maybe in unearthing the truth about Dr Bexley she would 
stumble across something about Alex's father. If not only for her 
sake, what a relief that would be for Alex! No, Deianeria must 
continue, that much was certain. In a way her dating Alex was 
the perfect smokescreen. There is no way suspicion could be 
aroused if she was in a healthy relationship. It was worth 
bringing Deianeria in early, as now she had the perfect cover. If 
asked she could state she was looking for clues about Alex's 
father. That was true to a point, although she wasn't sure what 
Cathline's reaction would be.

Elizabeth checked the clock on the bedside table, it was seven 
am and she was the only one up. Alex normally had a lay in until 
ten, with her parents rising at about eight. As always Cathline 
was a wildcard but Elizabeth knew she could handle Cathline. 
Wearily she got out of bed and headed towards the spare room. 
She would change into some more of Dr Bexley's clothes and 
do some research before breakfast. She decided to try out 
Deianeria as she had planned it. For the duration of her 
research that morning Elizabeth would be gone and only 
Deianeria would remain. 

Elizabeth closed her eyes and concentrated, she breathed in 
and out and performed her relaxation technique. In her minds 
eye she imagined filing away Elizabeth into a PDA and loading 
Deianeria into her active area. The process took a few minutes 
as Elizabeth prepared herself for the simulation.

When it was complete Deianeria stood up and stretched. It had 
been too long. After having a quick look around she walked out 
of Elizabeth's bedroom and into the spare room. 

Her first thought was how messy everything looked but she 
resisted the urge to tidy up. Elizabeth could do that for her. 
The first thing she needed to do was check the journals and 
figure out a plan of action. Whatever had gone on before, it was 
clear that Elizabeth had been too nice and too discrete. Such 
methods would take far too long and eventually lead to the 
wrong result. Deianeria decided that it was time for no more nice 
miss priss. 

She thought back to the hurt that Nick had caused Elizabeth. He 
was a bastard, no doubt about that. Something would need to be 
done about him. But first the journals. She eventually found a pile 
of small notebooks lying in the bottom of one of her chests. The 
first three contained writing, and they weren't the ones she 
wanted. They were for public consumption. The real ones she 
wanted were the blank ones underneath. All she needed now 
was an ultraviolet light source. She was amazed that nobody 
had wondered why she'd kept seemingly empty notebooks, but 
then again people were stupid like that. She would have thought 
Kat and Cathline might have deduced it but then again with all 
threats gone there was no reason to suspect anything. 

Deianeria glanced down at herself, still wearing Elizabeth's 
nightdress. It was time to change all that. She stood up and 
found a suitcase with some of her favorite outfits in. She quickly 
chose a deep purple blouse with a bleeding heart embossed on 
the left breast and after a bit of searching found her long black 
skirt. It was a shame Elizabeth had cut her hair short, but it 
would soon grow again. Feeling much better, she went back to 
her searching. 

A few minutes later she found what she was looking for. It was a 
large hardback book entitled 'Human Molecular Genetics'. Of 
course much of it was out of date now but it wasn't the contents 
she was after. She flicked thru several pages, scanning each 
one until she reached page 473. She had noticed that the letters 
on each line in the second paragraph spelt 'Guild'. Flicking to 
the right she saw a series of numbers. Taking the first three lines, 
a telephone number was formed. She quickly memorized it and 
decided to go and give it a try. She still needed a UV light of 
some description in order to read the notebooks.

The house was quiet and to her satisfaction she noted that 
nobody had yet woken up. She checked the grandfather clock in 
the hall. It was seven thirty. She had half an hour left before 
Elizabeth would be needed. Just enough time to make the 
phone call. She dived into Matthew's office and dialed the 
number. To her surprise an Arabic voice answered "yes"

"Hello, this is Deianeria. I have a job for you."

-- o -- o -- o --

Cathline had found it hard to sleep and lay in bed trying to rest. 
"This is no use at all," she muttered and swung her long legs off 
the bed. She couldn't sleep for any reason she could think of it 
was just one of those nights. She debated going for an early 
morning swim and indeed Elizabeth would probably be there so 
it would be a good excuse to see what she was up to. She also 
wondered how Alex had got on with Elizabeth the previous 
evening. She had heard them come in about 2am, so it couldn't 
have been that disastrous for them. That was another thing she 
would ask Elizabeth when she saw her. 

Deciding on an early morning swim, she took off her nightdress 
and found her black thong bikini. There weren't many women of 
fifty who could still wear it and carry it off but Cathline was no 
ordinary woman. Her specially designed body seemed to age at 
half the rate of other women's and she could still pass for a 
woman in her early thirties.  She adjusted her eye patch and 
went outside into the hallway.  As she walked past Matthew's 
office she heard the faint sounds of music coming from inside.

        "Can't you see what you are doing to me?
        Can't you see what you have done?
        As I try to pass another long and sleepless night,
        A hundred crazy voices call my name,
        As I try to pass them by,
        I almost can believe that she is here,
        Here in the glow of the night. 

        Do you know what you have done?
        Do you know what you've begun?
        Do you see we shall never be together again?
        All of my life."

Cathline decided to investigate and opened the door. 
The room was in darkness and only the lights from the hi-fi lit 
the room. Cathline's eye quickly adjusted to the darkness and 
she saw a figure sitting on a chair.

"Hello Cathline," the voice said and the music stopped.

The tone sent a shiver down Cathline spine. It was the same 
tone and intonation as Dr Bexley had had when she'd said those 
same words to her so many years ago. 

"Elizabeth?" Cathline queried.

There was a pause for a few moments and the figure spoke.  
Her voice, it was almost a different voice from a different person. 
Cathline however couldn't be sure -- there was subtle differences 
in the intonation and intent. Where the previous one had been 
full of veiled menace this was full of warm greeting. "Hi Auntie 
Cathline. Did I freak you out?"  

Freak out wasn't the words Cathline would have used. "I did 
wonder what'd you doing in the dark?"

"You never listened to music in the dark before?  Lights." 

The lights slowly came on and showed Elizabeth sitting on 
Matthew's chair with her feet on the desk. She had number of 
notebooks on the table and Cathline caught a glimpse of that 
bleeding heart motif on Elizabeth's blouse.

"What are you doing still wearing her clothes. I thought that joke 
was over by now?" Cathline demanded

"What?" Elizabeth glanced down. She couldn't remember 
putting that blouse on. How'd she get into Matthew's office 
anyway? Cathline mustn't be made more suspicious than she 
already was. "Sorry, I just thought it looked a neat outfit. Mom 
and Dad's room is directly below the entertainment room and 
I didn't want to wake them up so I used dad's office."

Cathline was still suspicious but as usual Elizabeth had a 
plausible explanation for everything. So she decided to let it 
pass and tell Matthew and Kat about this latest episode as soon 
as she could. She decided to change the subject "How'd it go 
last night."

Elizabeth thought back to that wonderful dinner and her first kiss 
with Alex. It would be better if Alex and she told their 
respective parents at the same time.  "It went ok. Alex surprised 
me."

"How so?" Now Cathline was intrigued. Elizabeth wasn't often 
surprised.

"He made me wash up and then we ate. He also knew the chef 
at the Hilton and spoke Portuguese. I didn't know he could do all 
that stuff."

Cathline gave a smile. That was typical Alex. "There's a lot 
about my son you don't know. You know he'd been planning that 
for weeks?"

Elizabeth nodded "So I gather. Anyway I'm sure you'll hear all 
about it later when he bothers to wake up. Speaking of waking 
up, you look dressed for a swim. Want some company?"

Cathline almost breathed a sigh of relief. This was the normal 
Elizabeth speaking. "Sure."

Elizabeth smiled. "I'll just get changed and I'll join you in a few 
mins. If you can keep up that is!"

"Yeah, right. I've a four inch height advantage over you," 
Cathline stated. 'Let's see how she reacts to goading' Cathline 
thought.

"And I've got twenty years on you. I'd better hurry," Elizabeth 
collected the blank notebooks and ran upstairs.

Elizabeth was confused. How and why was she in Matthew's 
office. She didn't remember getting dressed either and why was 
she holding some blank notebooks? There was only one 
conclusion -- it must have been Deianeria. Elizabeth reached her 
room and started to take off the blouse and skirt. She  
accessed the Deianeria simulation, and she then knew why she 
needed the notebooks. She had remembered seeing them 
stacked in a box in the spare room but had paid them no 
attention. Now, it would seem that the notebooks could be the 
keys to it all. Strange how'd she'd overlooked them before 
and gone onto other things. The outfit Deianeria had chosen 
was cool but what else had she found before Cathline had 
interrupted her? Elizabeth couldn't quite remember, so she 
dismissed it as either unimportant or irrelevant. 

She did find it disconcerting that the Deianeria simulation 
seemed to have a life of her own and that seemingly Elizabeth 
was out of the picture while Deianeria was active. However, 
Elizabeth took comfort from the fact that although Deianeria 
could do things that later Elizabeth had no immediate 
recollection of, it was Elizabeth who had final veto and control of 
-- effectively -- the on/off switch.

Elizabeth quickly put on her swimsuit and went downstairs to the 
pool. 

-- o -- o -- o --

Alex got up at his customary ten am and proceeded to take a 
long shower. He couldn't believe the events of last night. How 
could someone like Elizabeth fall for a clown like him? Elation 
was too mild a word for the way he felt. It was though he had 
hooked into his destiny and nothing in heaven and earth could 
prevent him from entering into it. He knew by now that everyone 
would be up and awake, and wondered if Elizabeth had told 
anyone yet. He suspected not, as she would want him to see 
Matthew, Kat and Cathline's faces when they broke the news.

Anyway it was time to face the music and his new beloved! Alex 
dried himself down and put on his now customary shorts and 
wild patterned shirt. Walking downstairs and outside to the pool, 
he found Elizabeth still swimming lengths. Cathline was 
allowing the sun to dry herself off. Matthew and Kat were at the 
far end of the pool just pouring themselves another cup of 
coffee. 

"Hi folks," Alex called out.

Elizabeth stopped swimming for a second to give Alex a wave 
and a wink. Alex's heart leapt once more. She hadn't forgotten. 
It wasn't a one off! She IS mine!

By the time Alex had walked around the other side of the pool to 
join his mom Elizabeth had pulled herself from out of the pool 
and was standing beside him. She gave Alex a crafty look and 
then took hold of his hand. Alex was pleased to see the shocked 
look on Cathline's face as she noticed their held hands. The 
look of shock turned to a wide grin and she said "You two kept 
that quiet!"

Kat had just finished pouring Cathline's black decaf and had 
glanced round to check if Cathline was still there. Much to her 
amazement she saw Elizabeth and Alex holding hands! Now 
that was a turn up for the books. 

"Liz?" Kat called.

Elizabeth whirled around but tellingly still had hold of Alex's 
hand. "What mom?"

"How long has this been going on?" Kat asked with a smile. It 
was so good to see Elizabeth in a relationship. They were 
starting to get worried.

"Since last night. Anyway, we're off to Male after lunch for some 
shopping. You want anything?" Elizabeth asked. She was after 
one item in particular, a UV light with which to read the notebooks. 

Kat shook her head. "No thanks. John left first thing with the 
yacht. You'll have to fly."

"Suits us." Alex called back.

"We're just off for a walk to Stephanie's cove," Elizabeth called.

Kat gave Elizabeth a permissive nod. It really WAS so nice to 
see them together. She'd had a suspicion for a while that 
something like this going to happen, but now that it had she was 
determined to give them enough space to make their own minds 
up. 

Cathline walked over to collect her coffee as Elizabeth and 
Alex walked off, still hand in hand. "Remind you of anyone?"

Kat smiled, "Maybe, but Matthew and I never fought as much as 
those two did. "

"We never fight," Matthew joined in.

"Yeah right. I've seen you on a Jetski," Kat jibed.

"We'll just let them get on with it," Matthew suggested,

"Just what I was thinking," Kat replied.

Cathline's face took on a serious look, "I caught Elizabeth in 
your office today Matthew. She was still wearing Dr Bexley's old 
clothes and she was sitting in the dark listening to music. When 
I walked in she spoke to me just like SHE did at the height of her 
fury. "

"She often goes in my office when she gets up early. That way 
she doesn't disturb us. What'd she say?" Matthew stated

"All she said was 'Hello Cathline.' She then waited for a few 
moments and then her voice was perfectly normal again," 
Cathline stated.

"I dunno what to think. Now she's going out with Alex I think 
she'll be ok. He'll notice anything awry soon enough. I think she 
enjoys stringing us along. I think she's trying to wind you up, 
Cathline," Kat said. Elizabeth could be such a tease when she 
wanted to be. Not in the overt way that Alex was but she 
enjoyed playing mind games with people for her own 
amusement.

"It IS nice to see them together isn't it?" Cathline commented 
once more.

"Sure is. I don't know how long it will last once she starts back to 
Cambridge. Mind you she's back at Harvard next year so it 
should make things easier for them, if they last that long that is," 
Kat commented.

-- o -- o -- o --

A few hours later Alex and Elizabeth returned from Male. They'd
spent some of their time shopping but mostly they had spent 
their time just being together. Places that had become mundane 
and routine as they had grown up now seemed fresh and new 
when they were together. Elizabeth was happy, as she'd 
managed to obtain a small UV lamp from a photography shop. 
She had told Alex she needed to study, to get ready for her next 
term, and would he mind leaving her alone for a few hours. She 
promised she would be with him for dinner, and that seemed to 
pacify him. In any case Alex had wanted to fly the model aircraft 
he'd made with John the summer before, so that was fine with 
him.

Elizabeth plugged the light in and retrieved the first notebook. 
Was it worth getting Deianeria involved? Not at the moment -- this 
was study not simulation. Once she had more information then 
she would invite Deianeria to help out. 

Elizabeth placed the first blank page under the light and after a 
few seconds writing appeared.

	"Exile Day 4

	Took the plane to Lhasa. The flight from the US was torture, I 
	was expecting to be hounded by the press but they didn't 
	recognize me. I can't believe Matthew has done this to me. I 
	knew he was after something when he jilted me but it seems 
	he's out to frame me for kidnapping!

	What in hell does he want from me? Anyway I've taken the best 
	way out I can think of. I'll spent a few weeks in Tibet. It's a place 
	I've always wanted to go to and this is as good a chance as any.

	Hopefully by the time I get back this will all have died down."

Elizabeth stopped reading. She didn't believe what she'd just 
read! She got up, switched the light off and went to the spare 
room. After a few minutes of frantic searching she found one of 
Dr Bexley's old workbooks from when she was at Harvard. 
Elizabeth also took one of the normal notebooks back for 
comparison.

In her room she opened the normal notebook and placed it 
alongside the blank one. She switched on the light again and 
studied the handwriting. Too all intents and purposes it was the 
same handwriting. However, closer study revealed that the loop 
of the 'e' and the tail of the 's' were a little different on the normal 
one. She then opened Dr Bexley's old workbook and studied the 
handwriting on that. It took a few moments for her to study the 
page but the evidence was clear. The person who'd written in 
UV ink and the workbook were the same person. The person 
who'd written the so called diaries of Dr Bexley was a 
DIFFERENT person altogether.

She quickly got her PDA out and placing it screen down on each 
book scanned a page from each. "PDA find the foremost 
handwriting expert who can give me 24 hour turnaround on the 
samples just scanned. Mail them to him and let me know the 
findings"

"Yes Elizabeth," The PDA answered back.

Elizabeth flipped to the next page of the blank notebook and 
continued to read.

	"Exile Day 6

	Arrived by land rover in Qinghai province. There's a nice hostel 
	just inside the border, which I'll be staying at for a while. I'm 
	looking forward to the expedition.  It's not every day you get to 
	go on a trek to find new medicines. Hopefully it'll take my mind 
	off Matthew and his scheming friends. I can't believe how 
	brazen they were, talking about their plans to defraud us in the 
	restaurant like that. It's by chance I overheard them on my way 
	to the conference. Even Cathline is involved. Just how deep 
	does this conspiracy go?

	I was staggered when I saw an identical copy of me walk in and 
	sit at their table. Whoever did the surgical reconstruction on the 
	woman did a brilliant job I was almost convinced I was looking at 
	a clone. That doesn't excuse what they are accusing me of. 
	Murder and Kidnap, yeah right, as if."

Elizabeth shook her head in disbelief. These books must be 
forged, They had to be wrong. Elizabeth changed to the second 
book.

	"Exile day 93

	Somewhere in Amdo province

	I have had some horrible news. I can hardly bear myself to write 
	it. My parents are dead. They were killed in an auto crash a 
	week ago. I never even got chance to say goodbye. Mom and 
	dad, why?"

The letters looked a little smudged to Elizabeth. She thought it 
looked as though Dr Bexley had been crying when she wrote it. 
If that were the case then a DNA sample of the pages would 
provide more proof to the case. After scanning in a copy of the 
page with her PDA continued to read.

	"The police say that they swerved to avoid a falling tree in a 
	thunderstorm and crashed over the edge of a cliff. The car 
	following behind was able to stop in time. Apparently they were 
	killed instantly. It also seems as though I am to go on trial for 
	murder. How can that be? I've been here for 93 days. It must be 
	that woman I saw in the restaurant. I have to go back to say 
	goodbye to Mom and Dad. I am now an orphan."

More smudges masked the rest of the page. Elizabeth sat back 
on the chair, still shell shocked from the revelations on the page. 
If the person who wrote this was really Dr Bexley, if the 
handwriting and DNA matched, then it would prove that Dr 
Bexley really was an unwitting victim of her parents deception. 
She tore out the page with the smudges and placed it inside her 
desk drawer. She would seal it off and sent it off to Cambridge 
for comparison with her own DNA. She would know in the 
morning if the handwriting matched, and that was good enough 
for the moment. 

She decided that after tomorrow she couldn't bear to stay any 
longer in this house of liars. They may not have killed Dr 
Bexley's parents but they did drive her away. The cult leader 
was right after all.  Hardly able to walk Elizabeth stood up and 
walked to her bed. Unable to control herself any longer, she 
burst into tears until she sobbed herself to sleep.

-- o -- o -- o --

When Elizabeth awoke the next day the notebooks and 
workbooks were gone and her room has been tidied. Alex was 
sitting on the chair next to her bed looking concerned at her.

"Hi Kiddo. You gave us quiet a scare, "he said softly

"I found it. I was wrong about them," Elizabeth sniffled. Why did 
her arm hurt?

"No you weren't. They showed me the notebooks and the UV 
lamp. They didn't do it. It was all a trick," Alex said gently 
stroking Elizabeth's face.

"How can it be a trick. Where are they now?" Elizabeth glanced 
down at her arm and noticed a small red pinprick. She'd been 
injected with something.

"The notebooks? Your dad has them I think he's going to burn 
them or something."

Elizabeth sat up, "No he mustn't. He can't!"

"I'll make sure he doesn't. We found you still crying last night -- 
you glared at us and shouted at us to go away or you'd kill us. It 
really freaked us out, I can tell you. Who's De-an-era? "

"You mean Deianeria? That's the name of the project I've been 
working on. Look, I'll be down in a few minutes. Thanks Alex." 
Elizabeth said and gave Alex a kiss.

Elizabeth was worried. She had to get those notebooks back, 
they were her only proof.

She decided to dress in her normal clothes and made her way 
down for breakfast. Everyone was normal, too normal for her 
liking. It showed they were worried about her.

"Hi Elizabeth. Glad to see you're feeling better," Kat piped.

Elizabeth decided that lying was the best way to placate her 
parents. What action she would take now depended on the 
handwriting and DNA results. "Sorry about last night. I guess I 
goofed huh?"  

"It was typical of Dr Bexley to write a false account that would 
incriminate us if it ever came to a trial between her and us. Even 
though she's been dead for years she still has the ability to 
cause hurt to those we love. Elizabeth, please let this project 
of yours drop," Kat pleaded.

Elizabeth had considered the fraudulent entry possibility, but that 
didn't equate for the difference in handwriting. 

Elizabeth just nodded in agreement and ate her breakfast. She 
would have to see what Deianeria made of it.

An hour or so later, just as she was about to go into the pool, Kat 
came running out with the phone. "It's for you -- I think it's 
Angela."

Elizabeth grabbed the phone. It had been too long.
"Angela, Hi. How are you? Looking forward to going back?"

"Hi Elizabeth. How's that island of yours?"

"I haven't blown it up yet if that's what you mean. Listen, I've got 
so much to tell you I can't wait to get back." Elizabeth was 
delighted to speak to Angela again. After nearly two weeks it 
had been too long.

"The reason why I called is that I have some bad news,"

Elizabeth's tone dropped. She knew Angela's parents were poor 
"Look if you can't afford to come back I can help."

"No that's not it. You remember Nick, as in ex boyfriend Nick?"

"Yeah. He was cheating on me wasn't he?"

Angela's voice took on a more serious tone. "They found his 
body in the Thames. It looks as though he'd been murdered. His 
throat was slit and he'd been dumped in the river."

"Oh my God. Do they know who did it?" Elizabeth felt a tinge of 
sadness. Nick had been nice and she would miss him.

"Nope. The press over here is calling it a Guild style killing. His 
pockets were empty and his wallet gone so the police think it 
was a simple mugging that went wrong. Oh Elizabeth, it's so sad. 
I know he didn't treat you well in the end, but this is horrible"

"I know. I feel sorry for his parents. I expect they'll find out who 
did it soon enough though," Elizabeth said softly.

Angela's voice gave her agreement. "I hope so."

-- o -- o -- o --

"Kat what the hell are we going to do with her?" Matthew asked.

"That Olanzapine injection should help her. Why did she freak 
out like that? Sure, reading those notebooks triggered it, but even 
that shouldn't have done it" Kat asked.

"You think she missed a few doses of her drug? If so how come, 
she takes it everyday," Cathline asked.

"We'll know soon enough. I think she's worried about going back 
and what's going to happen with her and Alex. She wouldn't say 
it of course but that's a factor. That project she's got running is 
taking a lot out of her. We ought to put a stop to it before it really 
hurts her." Kat's voice was showing real concern. She couldn't 
recall Elizabeth being this upset since she'd found out about her 
real mother.

"We can't put a stop to it. If we try she'll think we're trying to 
cover something up and it'll only make things worse," Cathline stated.
"Where are the notebooks anyway?" 

"Locked away in my office safe. I changed the combination too, 
so they should be ok in there. Cathline, do we inform the 
authorities or not? I was against it at first but I'll do whatever's 
best for her. If that means she's locked away for her own and 
others' safety then that's a cross we have to bear. Matthew's 
voice was full of sadness. The thought of his 'little mite' locked 
away and unable to lead a normal life was almost unbearable. 
However the thought of her killing anyone was worse. Who 
knows what she might be capable of?

Cathline thought long and hard "No we don't. I know it's my son 
in the firing line, if anything happens, but I can't do this to her. 
Let's let Alex work this out with her. That's the one thing Dr 
Bexley lacked, someone to care for her and love her, not in 
a parental way but in a friend and lover's way. I know I wanted to 
be that person to her, but she never really opened up to me. All I 
was, was a means to an end. By the time I was on the scene it 
was too late, the damage had been done. If Alex can be there 
for Elizabeth then I see that as our only hope."

Kat nodded her agreement. "That's some wise words, Cathline. 
But it's a big burden for Alex. Do we tell him?"

Cathline shook her head, "No. How can we? 'Oh Alex we just 
thought you might like to know that your new girl friend could 
turn on you and kill you on the slightest whim.' If we tell him he 
will change his behavior towards her, and she'd 
know something was wrong. Let's let love take its course."

"And if Alex dumps her? Then what?" Matthew said, an element 
of fear crept into his voice.

"Easy. We get him out of there as soon as we can and make 
Elizabeth submit to the test," Kat stated. It was the only safe 
way out.

"Agreed," Cathline said.

Matthew nodded his agreement.

Kat just hoped Alex was up to it.

-- o -- o -- o --

Alex found Elizabeth in Stephanie's cove. She was sitting on a 
rock looking out to sea. "Hi Kiddo. Need some company?"

Elizabeth turned to face Alex, her eyes red with tears. I'm sorry 
Alex. Yeah, please sit down. I need to talk."

Alex nodded and sat down beside her. He put his arm around 
her and drew her close. In response Elizabeth put her head on 
Alex's shoulder. She needed him more than ever at the 
moment.

"You're in a real state aren't you?" Alex said gently tousling 
Elizabeth's hair.

Elizabeth gave a sniff and nodded. Her head still rested on 
Alex's shoulder. "I messed up. I thought I could do it. But you 
can't discredit the evidence I've found. There's something odd 
going on Alex, but I can't put my finger on it."

"I didn't see the notebooks, but from what mom told me they 
were from a diary Dr Bexley had written about a trip to Tibet. 
They named Matthew, Kat and mom as trying to set her up. 
Elizabeth, you can't verify Dr Bexley's story. By now all records 
of her trip would be gone and all a handwriting expert could tell 
you is that she wrote it. It doesn't prove they were true, only that 
she wrote it."

"It's not just the notebooks, it's everything. Angela called a while 
ago today. Nick, my ex-boyfriend, was found dead yesterday." 
Elizabeth started to cry.

"Oh Elizabeth. I'm so sorry. What happened?" Alex pulled 
Elizabeth closer. Why did Elizabeth always get the rough end of 
things? He wished that he could do more, even take on some of 
the pain she was feeling herself.

"Someone murdered him. Stole his money and slit his throat. 
Why would they do that? He hadn't hurt anyone except me, and 
sure, I was mad at him. But this! I never wanted anything like this 
to happen to him."

"It's a cliche, but bad things happen to good people, Elizabeth. It 
sucks but it's true. Whatever happens, I'm here. No matter what 
you do, where you go, or what you say to me, I'm here for you."
Alex turned Elizabeth's face towards him and gave her a kiss.

Elizabeth felt much better. Knowing that Alex was here for her 
made all the difference. He was correct about the notebooks, but 
so much didn't add up about this whole thing. The truth had to 
be somewhere, and in spite of what had happened she was 
determined to find it. Only one way remained -- she had to let 
Deianeria take over for a while. Not yet though. She needed to 
mourn a little for Nick and pacify her Mom and Dad. "Alex?"

"Yes"

Elizabeth cuddled Alex some more "I don't want to stay here 
anymore. I want to go to New York. I have too little to do here, 
it's driving me stir crazy. In any case I need more stuff ready for 
next term. I was going to get them in London, but New York is 
better. Please come with me." 

"Inviting me off for a dirty holiday are we? I thought we'd take 
things a step at a time," Alex joked.

Elizabeth didn't laugh. In the old days she would have slapped 
him, but now she saw it for what it was, an attempt to cheer her 
up. "Please Alex. I need you close."

Alex gave Elizabeth another kiss, "I'm there."

-- o -- o -- o --

"I hope you're not going because of us?" Matthew asked 
Elizabeth. He'd been hurt by her announcement. It seemed to 
him that she was disassociating herself from Kat and himself.

Elizabeth gave Matthew a big father-daughter hug, "Don't be 
silly Dad. I need to get sorted out for next term and I can't do it 
here in the middle of the Indian Ocean. Alex is coming too, so I'll 
be ok. Really dad, all that business is over and done with."

"If you're sure you're ok then that's fine. We'll be over the first 
week back to check you're ok." Matthew returned the hug. It had 
been too long since she'd hugged him like this. He did wonder if 
Elizabeth was play acting, but it felt genuine enough. 

"Dad, I'm fine, really. I leave first thing in the morning. Alex is 
flying over a couple of days later. Hey, I promise I won't trash 
the place," Elizabeth smiled.

"We trust you," Matthew said. That was all he needed to say to 
tell Elizabeth that she was on her own, that they would be there 
for her if she needed, and that they still loved her. 

Elizabeth got the message, "Thanks dad."

In spite of her early start the next morning Elizabeth woke at 
2am. She gently opened her bedroom door and let her eyes 
adjust to the semi darkness before creeping out of her room. 
She knew what she wanted and where to get it. It took her a few 
minutes to creep downstairs and open the door to her dad's 
office. After gently lifting the carpet, she took a look at the safe 
now nestling under it.

She tried the old combination of "072096" -- which was her 
parents wedding anniversary -- but that didn't work. She quietly 
swore. She now only had two chances left before the alarms 
sounded. What else could it be? She tried her own birthday of 
"052002" but the bleep told her it hadn't worked. Only one 
chance remained and only one choice. Elizabeth closed her 
eyes and within a few moments Deianeria opened her eyes.

That little miss priss Elizabeth had so nearly messed things up. 
She needed those notebooks, as they were the only way she 
could be free. Now think!

Elizabeth had tried the obvious one of anniversaries and 
birthdays so it couldn't be that. What was another memorable 
date that Matthew in a state of distress would think of? It would 
have to have something to do with Elizabeth, as she would be 
on his mind at the time. What event from Elizabeth's life would 
stick in Matthew's mind apart from Elizabeth's birthday? In a 
flash she had it! She had been thinking too much like Elizabeth 
and it had nearly cost her the precious diaries! After reading the 
diaries Matthew wouldn't be thinking about Elizabeth -- he would 
be thinking about HER. So what date would Matthew most 
remember about HER? Of course, the date he was supposed to 
marry her. Now what was it?

Deianeria thought back to what she'd read about it. That was it. 
She dialed "082493" and the safe swung open. In the back of 
her mind she could hear Elizabeth telling her that her job was 
over and it was time for her to take over once more. 

"Not yet miss priss," Deianeria whispered to herself.

"I said now!" Elizabeth's voice told her.

"You need me to find the other useful stuff from the spare room. 
If you leave them behind you'll never get them back!" Deianeria 
whispered out loud.

Deianeria waited for a few moments. She hated being 
subservient to Elizabeth but for the time being it was the only 
way. 

"Ok collect the stuff, then we go," Elizabeth's voice told her.

"Ok," Deianeria whispered back.

"One last thing. Did you have Nick killed?" Elizabeth's voice 
sounded worried.

"Could I kill anyone? I AM part of you. Could you?" Deianeria 
hissed.

"No. Sorry I asked. We'd better get a move on," Elizabeth 
conceded.

Deianeria gave a wry smile. Elizabeth could be so naive 
sometimes. After collecting the notebooks she shut the safe and 
turned the dial back to what it had been set at. She was glad 
Elizabeth had switched over to her. Elizabeth hadn't even 
registered the old positions -- fortunately she saw everything 
Elizabeth did and had made a note of it. It was now clear that 
she could keep things from Elizabeth if she chose to and 
therefore it would be logical if Elizabeth could too. However, 
Elizabeth needed to share everything with her for the work to be 
done. It gave her a lot of pleasure that it didn't go the other way 
around.

Deianeria replaced the carpet and ensured that the crinkle was just 
in the same place too. Elizabeth hadn't spotted that either! She 
mentally sighed. Elizabeth was such an amateur. After closing 
the door Deianeria crept upstairs and into the spare room. 

Part of her wanted to retrieve her clothes but they would only 
take up room she didn't have. The original notebooks had been 
put back but they were useless to her. She suddenly had a 
thought and moved over towards the pile of Matthew and Kat's 
stuff. She had to take the risk of putting the light on, but as long 
as she didn't make a noise it should be ok. 

After switching the lights on Deianeria found a leather bound 
folder and opened it up. It contained the account details of 
Matthew and Kat prior to the year 2000. This ledger would be 
invaluable in finding out if any financial irregularities took place. 
Deianeria picked up the ledger and a few of Cathline's 
notebooks and gently closing the door behind her went back to 
Elizabeth's room.

Once again she heard Elizabeth's voice telling her to leave, but 
she still had things to do. "Do you want to sleep on the plane or 
let me work on these?" Deianeria answered back.

"It would be efficient to work on these on the plane. Once Alex 
turns up it will be hard to do anything on this," Elizabeth 
admitted.

"I like Alex. I hope he doesn't betray us," Deianeria stated.

"What's that supposed to mean?" Elizabeth said nervously.

"It'd blow the entire thing wide open wouldn't it. It's vital he 
knows nothing of this until it's over," Deianeria said. Elizabeth 
was getting nervous that much she could tell. 

"Agreed," Elizabeth said. 

"Are you going to fuck him when he arrives?" Deianeria asked.

"No. I want to wait," Elizabeth said determinedly. Kat had told 
her how special it was to save yourself for the one you really 
loved. How presenting yourself to him as a pure virgin was one 
of the most precious gifts a woman could give.

"I think you should fuck him. So you know what's it's like. If I 
were you I would just take him. Let him know who is boss, 
dominate him. I would put my cunt in his face and make him lick 
me out," Deianeria said seductively. 

Deianeria reached down beneath her nightdress and felt herself 
becoming moist and aroused at the thought of possessing and 
dominating Alex. It had been too long since she'd felt like this.
Instinctively her finger went inside and caressed her clitoris and 
a small whimper escaped from her mouth.

"Stop this!" Elizabeth demanded.

"Why? You know you want this as well. You know you want to 
feel his warm cock inside you and feel him thrust in and out. You 
know you can't wait to feel his cum inside you and that warm 
afterglow that comes from orgasm," Deianeria crooned. She 
was feeling jolts of pleasure as she moved her finger in and out 
of her.

"Hmm that's nice," Elizabeth admitted.

"See, told you," Deianeria gasped. She had now laid herself on 
the bed and was now fingering herself with both hands. The jolts 
of pleasure were getting greater and more frequent and she 
could feel herself nearly reaching climax. She rolled her 
nightdress up to reveal her full firm breasts. She put a hand her 
left breast and started to gently tease the nipple. Another wave 
of pleasure rippled thru her.  "This bit is private", she told 
Elizabeth and closed down the conversation.

In her minds eye she visualized Alex, spread-eagled on the bed. 
His hands bound by handcuffs and his legs spread apart by a 
large iron spreader bar. Alex's cock was erect and waiting for 
her to mount him. In Alex's mouth a ball gag stopped him from 
saying anything. She stood over Alex and gently started kissing 
his muscular thighs and slowly she teased herself so that her 
mouth was just above his cock, "I'm not going to fuck you"
She heard herself say, "Because penetration means you have 
some power over me. I'm going to do this instead!"

She bent down and put her mouth over Alex's throbbing cock. 
She teased it with her tongue and gently sucked on it. She felt 
Alex tense as she moved her mouth and tongue all over it and 
she knew he was ready to come. Still caressing Alex's cock with 
one hand. she picked up the small dagger from the side of the 
bed and hid it behind her back. She moved back to sucking 
Alex's cock and felt his body twitch as he started to come. She 
quickly took her mouth away from Alex's cock and saw his cum 
come pumping out. Alex lay back in the afterglow of orgasm 
unable to move, powerless and bound. He tried to scream as he 
saw Deianeria whip the dagger from behind her back but the 
scream was stifled in his throat as Deianeria cut his neck open.

The image faded and Deianeria gave a loud moan as she 
reached her own climax. Her minds eye showed a picture of 
Alex's blood seeping out over the bed and in the midst of her 
orgasm she was wiping it all over her breasts and into her cunt. 
She gave another moan of pleasure as another orgasm hit and 
this time the pleasure came not from her fondling of her pussy 
or of the kill but from the thought that this is what she would do 
to Alex if he dared to break her heart.

-- o -- o -- o --
 

Matthew was banging on the Elizabeth's bedroom door for a full 
five minutes before Deianeria answered the door. "Hi dad," 
Deianeria said, her voice full of innocence.

"The chopper leaves in half and hour. You're normally up before 
us. Are you ok?"

Deianeria wiped her hair away from her eyes, "Yeah fine. Sorry I 
must have overslept. Gimmie a few minutes and I'll be back 
down."

"Ok," Matthew said and shut the door.

Deianeria fumbled around in Elizabeth's bedside drawer and 
found an E-mail waiting on Elizabeth's PDA. 

        "To ECSTEPHENS@Stephens.corp
        From Professor Michael Cromwell Ph.D.

        Elizabeth,

        Thanks for your scans. They are very interesting both on a 
        technical and personal level. It seems as though the samples 
        from the workbook and the UV inked notebook are from the 
        same hand. The sample in the notebook written in ordinary
        ink is from a different person. Of course it is possible
        these entries are forged, but in my opinion this is only a
        small possibilty."

Deianeria gave a smile. She had thought so. That was the only 
thing that made sense. She now knew what was going on, but to 
admit it to Elizabeth would mean that she would no longer be 
required. This was something that Deianeria was determined to 
avoid for as long as she could. Of course Elizabeth would see 
the E-mail, but she would reach the wrong conclusions. She 
would see to that.

She turned the PDA off and placed her bags outside the room. 
The chopper pilot would pick them up for her. Turning round, she 
went into the shower. It had been too long since she'd felt able 
to release the sexual tension inside her, especially in the way 
she liked it. Elizabeth had kept her body in good shape. That 
much was clear as her hand went down over her firm breasts, 
past her smooth flat stomach and onto her pussy. She resisted 
the temptation to go there again. She needed to focus, not get 
distracted by carnal pleasures. 

A few minutes later she dried herself off and on a whim decided 
to put on the bleeding heart outfit again. That was her favorite 
so it ought to go with her. A thought struck her. Elizabeth hadn't 
asked about the receipt. Should she do that now? Maybe not, 
do it over the phone once the ledgers have been studied. That 
way Matthew's answer could be verified against real figures. 
Deianeria considered that the ledgers could hide or exclude any 
payments for use in creating the fraud, but they would be hard to 
cover up. 

Time flew past and soon Deianeria had kissed everyone 
goodbye and was on the plane to New York. Elizabeth's 
nagging voice at the back of her mind reminded her that she 
was supposed to be working, not enjoying the flight over.

"I need to relax. Now go away," Deianeria commented.

"I can and I will shut you down for good. Now get on with it. I 
want this over and done with before I get back to Cambridge," 
Elizabeth complained.

"I've been thinking about that arrangement. Not good enough," 
Deianeria demanded.

"You haven't any choice in the matter. All I need to do is take my 
Olanzapine again and you are gone," Elizabeth said back. Her 
voice was sounding worried.

"When your parents gave you that Olanzapine injection it didn't 
last very long did it? If you ask me, your body is gradually 
building up a tolerance to the drug. In any case you need me 
around," There, that will get her thinking, Deianeria thought.

"I guess. Why do I need you? I can call this whole thing off right 
now and you'll be gone. It's got way, way out of track now. I 
never used to be able to hear different voices in my mind," 
Elizabeth stated.

"Because I've worked out what's really going on," Deianeria 
stated.

"How can you? You only have the same information as I have," 
Elizabeth called Deianeria's bluff.

"Because I can think and plan far beyond what you can do. 
You've seen that all along. That's why you asked me to help. I 
haven't yet worked out all the details, but one thing is for sure; 
you need my protection," Deianeria stated.

"From whom and from what"

"From yourself and from becoming what you fear the most," 
Deianeria said cryptically.

"What do I fear the most?" Elizabeth demanded.

"Hurting the ones you love the most. Becoming like me." 
Deianeria said it in a matter of fact way.

"So you do admit to being evil?" Elizabeth said. Deianeria  
thought she sounded very worried.

"Evil is such a subjective term isn't it? I am that part of you that 
gets the job done at any cost. I am the part of you that pushes 
you beyond what you fear so that you can conquer that fear. I 
am the part of you that drives your ambition. I am the part of you 
that wants to make you grow into something you could not 
normally be. If that is your definition of evil then call me it." 
Deianeria's voice spoke in a soft comforting tone.

"You're that part of me?" Elizabeth queried.

Still in her soothing tone Deianeria said "That and more. Since 
you freed me from your subconscious you have grown in so 
many ways. Without me there would be no you and Alex, because you 
would not have started to think of him in a serious way had I not 
been around. I know how you feel about him. A part of you is 
beginning to think he may be the one."  

"I guess so. You leave Alex alone!" Elizabeth said defensively.

"You're welcome to him. I have no interest in him at all. It's my 
further existence as part of your consciousness I'm after. In 
return I will keep you safe. I give you my word."

There was silence for a few moments. Deianeria knew Elizabeth 
was thinking but she couldn't tell what. If Elizabeth was thinking, 
she would be now be confused, full of conflicting emotions 
and doubt. This was of course what Deianeria was hoping for. 
She had to live beyond the project, this wasn't just mind games; 
it was a matter of survival! 

Elizabeth asking "How can we both live together?" It's either you 
or me in there?" interrupted her thoughts.

"All I want is your word that you will use me whenever you are 
worried or concerned. That's what I'm here for? I'm here to 
protect you." Deianeria crooned. She was winning the 
argument. For now the project didn't matter. If what she thought 
was going to happen actually happened then it would mean she 
would never need prissy Elizabeth again. She would be gone 
and only Deianeria would remain. For now her motives and 
findings would remain secret. They would be revealed soon 
enough.

Deianeria gave a smile as the naive Elizabeth said, "That's all? 
You just want to be around waiting for me to call on you?"

"That's all I ever wanted Elizabeth," Deianeria said softly.

"OK, deal. Under one condition." Elizabeth stated.

"Which is?"

"Tell me what you've found out regarding the project,"

"Done," Deianeria said.

Deianeria opened her eyes. Thankfully she hadn't made a slip 
and spoken out loud. That would have concerned a few 
people! There was one last thing she needed to clear up.

"Elizabeth?" Deianeria asked in her mind.

"Yes?"

I need to do some more reading before I can finally tell you the 
results. Can I stay until tomorrow morning? After that I'll be there 
waiting for your call?"

"Ok. I will take over at 9am tomorrow," Elizabeth stated.

Deianeria closed her eyes and went to sleep. It was going to be 
a long flight.

-- o -- o -- o --

Several hours later Deianeria landed at JFK airport feeling 
utterly exhausted. She had known before she had taken off 
what she was going to do and say, but it had worked out just the 
way she wanted. Goody two shoes Elizabeth had fallen right 
into her trap. She was so, so trusting and in a few months time 
she would pay the penalty. As she had told Elizabeth she was 
the part of her that would achieve the goal no matter the cost. 
She would also keep her side of the promise. She would keep 
Elizabeth safe, but only her body. All she had to do was play a 
waiting game and the person called Elizabeth Cathline 
Stephens would be no more. Sure her body would still be there. 
Deianeria needed it.  However the personality would be gone, 
replaced only with Deianeria.

Deianeria felt elated. Only a few more months of being a 
prisoner, of having to deceive and skulk in the shadows of the 
mind. Patience was a virtue and Deianeria had that in spades. 

After collecting her bags from reclaim she hailed a cab and an 
hour or so was letting herself into Matthew and Kat's Manhattan 
apartment. She so wanted to go to sleep but she wanted to 
make the most of this time of freedom. This would be her last 
chance for a while. 

Going into her bedroom she closed the curtains and she 
stripped off her clothes and admired her naked body in the full 
length mirror. She had to admit Elizabeth had kept it in pretty 
good condition but there was still room for improvement. Her 
arm muscles were a little weak looking and her thighs could do 
with some firming up. 

What would she miss the most in her months of Exile? Eating 
was overrated as was Elizabeth's relationship with Alex. 
Elizabeth had no idea how to get the most out of Alex for her 
own pleasure. She had these out of date romantic ideas of 
giving herself to him.  Elizabeth was welcome to them, they only 
had a few months left anyway. After that Deianeria would show 
Alex the real meaning of sex and relationships. A single night 
with her then Alex would be her slave forever. Unless of course 
he decided to run, and Deianeria already knew she would do in 
that event.

It was the glow of orgasm, of sexual pleasure she decided she 
would miss the most in the coming months. Her body gave a 
quiver of anticipation of the pleasure to come. She was about to 
run her hand over her breast, when a thought occurred to her. 
Angela was a threat to her future plans with Alex. Elizabeth had 
noticed how she had eyed him up when they had first met. 
Would Angela need to be dealt with as well?

Only if Alex and her became an item; but by then it would be too 
late. Therefore Angela's fate would match Alex's; it was the only 
way to preserve herself. Deianeria had a wicked idea, it was one 
that turned her on as much as the idea she'd had for Alex. Her 
hand reached down, and stroked the soft hair between her legs. 
Her fingers gently touched the lips of her vagina, and she gave 
a soft moan. Her other hand cupped her breast and the fingers 
ran little circles around her nipple.

Deianeria closed her eyes and imagined herself in a darkened 
room. The lights were dimmed and in one corner a figure stood 
against the wall. As she moved closer she saw Angela chained 
hand and foot to the wall. Wrapped around her body were 
several straps which had been fastened tightly, preventing 
Angela from moving. Angela's legs had been spread out to form 
an upside down Y shape. Deianeria saw with pleasure that 
Angela's pussy was exposed and waiting. 

Angela was wearing a black silky teddy and black nylon garters. 
Deianeria gave an appreciative glance up and down Angela's 
smooth, firm body. She moved in closer and gently stroked 
Angela's nylon covered breast.

"Elizabeth, stop it. Why am I here?" Angela gasped. Her eyes 
wide with fear.

Deianeria felt herself go moist as her fingers entered her. In her 
minds eye she reached over and kissed Angela full on the lips. 
Angela struggled to resist her but she was bound too tightly. 
Deianeria forced Angela's mouth open with her hand and her 
mouth and she felt Angela try and pull herself away. "I am going 
to take you now, bitch!" Deianeria whispered in Angela's ear.

Angela gave a scream as she felt Deianeria's finger stroke her 
exposed pussy. "That right scream, bitch!" Deianeria cursed at 
Angela and proceeded to push her finger upwards so that it was 
right against Angela's cervix. 

"No please. Elizabeth, no" Angela was sobbing. 

Deianeria pushed the helpless Angela against the wall and used 
one hand to reach down underneath her teddy and fondle 
Angela's breast. With her other hand she once again fondled the 
lips of Angela's vagina. To her surprise she found them moist 
and waiting. "That's more like it, Bitch!" Deianeria said.

"My God, no," Angela was calling out and her calls only served 
to make Deianeria more aroused. 

Still caressing Angela's breast and pussy, Deianeria moved in to 
kiss Angela once more. Angela by now had resigned herself to 
being raped by what looked like Elizabeth. But somehow this 
Elizabeth was far different to the one she knew. That didn't 
matter now as the new Elizabeth forced her tongue down her 
throat. 

Deianeria let the image fade for a few moments and moved her 
other hand down to her pussy. By now it was dripping wet and 
every stroke made her gasp with pleasure. She felt herself 
nearing climax and instantly she was back with Angela once 
more.

"Wait there bitch," Deianeria ordered and moved away from a 
relieved looking Angela. She returned a few moments later 
clutching something in her hand. Angela couldn't make out what 
it was and it was all she could do to scream as she felt 
Deianeria ram her clenched fist inside her. 

Deianeria gave a gasp of pleasure as she gently rotated her 
hand inside Angela. She found what she was looking for, a 
small button on the side of the metal object she had held in her 
hand. As Deianeria felt herself come she pressed the button 
and waves of pleasure crashed over her as she heard Angela 
scream. Ignoring the blood now pouring out over her hand 
Deianeria rammed the now open flick knife up into Angela's 
cervix and womb and gave it a twist before pulling her hand out.

Angela was now screaming in agony, all thoughts of being 
violated gone as soon as she had felt the searing blade go right 
into her. Just before she passed out she saw Elizabeth fondling 
herself with her bloodied fist.

Deianeria stood and watched Angela slowly die as the bleeding 
continued. With Angela's final breath Deianeria came and 
couldn't help but scream with pleasure as orgasm after orgasm 
came crashing over her.

Deianeria opened her eyes, exhausted by the pleasure she'd 
felt. That was worth it. Over the next few months she would 
remember this feeling and how it would soon come to pass in 
the real world as it had in her own.

-- o -- o -- o --

"Time to wake up," Elizabeth chirped to a still sleeping 
Deianeria.

Deianeria opened her eyes and checked the time. It was eight 
forty. "I still have twenty minutes left," She reminded Elizabeth 
and closed her eyes again.

"Yes but you promised to tell me what you've found out." 
Elizabeth demanded.

"Yes I did. Are you sitting comfortably? Then I'll begin.

"Very funny," Elizabeth commented.

"Ok, first things first. The receipt is a fake.  The signature is 
forged, it's a very good one but it's the only way that fits. The 
DNA test was easy to fake, as all it would take is a small hair 
from your dad and simple chemistry to produce a positive DNA 
test. How do I know this? Easy. Your dad didn't have fifty grand 
to spend on surgery, neither dad Kat or Cathline. Their bank 
account details show no sign of the money either being 
transferred or laundered."

"Why?" Elizabeth started to say.

"Not yet! Questions at the end. Your research was quite correct 
that using current theory and techniques DNA modification is 
impossible. What it doesn't take into account is the brilliance of 
Dr Bexley and her research team. She may not look it, or talk 
like it but Cathline is one clever bitch. I've been reading what 
records remain from TGEN. She was Watson to Dr Bexley's 
Holmes.  There can be no doubt that they stumbled on 
something the world has now lost or not reached yet. Just 
because we don't know how to do it now doesn't mean that we 
never knew how to do it. I'm sure given time together we could 
do the same as Dr Bexley did."

"I thought as much," Elizabeth commented. "But there's no 
physical evidence of it ever having been achieved. Only 
people's testimonies exist and they all may well have an interest 
in covering it up. Everything's been classified as top secret." 

"You forgot. There is evidence," Deianeria stated.

"Where?"

"In Syria. Remember Salah. He was turned into a replica of the 
half woman-half tiger creature that Kat was in order so that Kat 
could take his place. His parents had his body exhumed fifteen 
years ago and taken back to Syria for re-burial. If his skeleton 
showed extensive modification then that would be proof wouldn't 
it?"

"Damn, Missed that one," Elizabeth swore.

"That's why I'm here. Now you see why you need me," 
Deianeria comforted.

"But his parents would never consent.." Elizabeth started.

"I have that one all in hand. It will take a while to get the 
paperwork and their consent thru but in a few months time we 
will know one way or the other and the Children of Bexley cult 
will be gone. They will not be able to refute this evidence 
against them and so they will fold," Deianeria said triumphantly. 
What she hid from Elizabeth was the thought that in a few 
months there would be no Elizabeth around to enjoy it.

"You are so right Deianeria. You've done brilliantly. But what if 
Salah's body melted like the other changelings did when they 
died?"

"Dr Bexley only told Hassan he had installed a changeling organ 
in Salah. She was probably lying, why waste the effort if he was 
only to be killed. Besides Matthew needed to believe that Kat 
was dead, he couldn't do that if the body dissolved within a few 
moments. No, I am sure we will find all the answers in Salah's 
remains.

"What about the diaries. The handwriting matches and I suspect 
the DNA tests will as well," Elizabeth stated.

"I'm nearly at the end of that one but I can find no record of Dr 
Bexley ever visiting Tibet. I suspect they may be forged too. 
Placed there to distract you," Deianeria explained. It felt good to 
treat Elizabeth like a bright pupil with no hope of matching the 
teacher.

"By whom and for what."

"It's obvious isn't it. The Children of Bexley want to alienate you 
from your family so that you will join them. The receipt and the 
misdirection has to lead to that conclusion. It's the only one that 
fits," That's not all they are after Deianeria thought but kept it to 
herself.

"They think I can be the new Dr Bexley?" Elizabeth stated. She 
sounded worried.

"Very good little one," Deianeria said. Maybe she wasn't as 
dumb as Deianeria gave her credit for

"That's why you want to protect me. You want to stop them!" 
Elizabeth sounded hopeful.

"Got it in one. I'm the only one who can. I hope you see that 
now," Deianeria said as soothingly as she could under the 
circumstances.

"Oh Deianeria thank you. I knew you wouldn't let me down. I 
was wrong to distrust you. I'm sorry," Elizabeth apologized.

"That's ok. My time is nearly up and you need to get on with 
your life. I'll be here, waiting for your call. Don't worry you won't 
turn out like her. I promise it," 'That's because you won't be 
around to turn out like that' Deianeria thought to herself.

"Thank you Deianeria," Elizabeth said softly.

"Listen. You have nothing to fear from the past. Alex is here for 
you now. Put this project behind you and we'll move on 
together. Goodbye now," Deianeria said soothingly.

Elizabeth gave a yawn and opened her eyes. She felt a great 
sigh of relief. She hadn't been deceived by her parents or by 
Cathline. They did love her, they weren't killers and furthermore 
with Deianeria's help she now had nothing to worry about. She 
could get on with falling in love with Alex safe in the knowledge 
that her future was assured.

-- o -- o -- o --

Mark looked at the E-Mail in disbelief. No matter how many 
times he read it, it said the same. He had failed the last set of 
coursework and exams. If he didn't pass the retest in two weeks 
time then he would be kicked out and that meant unemployable 
and broke. 

He decided he'd spend less time fawning over women he 
couldn't possibly have and more time studying. If he did that he 
might just stand a chance of passing the course. 

The college had told him in the email where he was weak, so he 
set about studying those areas. Two weeks was no time in 
which to prepare, but it was all the time he had. His parents had 
bawled him out about working harder, spending less time 
partying with Wills, all the usual disappointed parental 
speeches, and much to his chagrin they were right. He was 
most upset at himself, he knew he could do better. He knew he 
was one of the brightest in his class but he just could never 
seem to find the time to study. Things had to change. In a 
weeks time he would be back at college and by his reckoning 
Anne Baxter would be back. Fresh from her adventures on the 
high seas, and he just knew that she would distract him as soon 
as he saw her.

His only chance would be to lock himself in his room after 
tutorials and work. Wills would understand, and as for Anne 
Baxter well she would just have to be such a babe and keep out 
of his way.

-- o -- o -- o --

Anne Baxter flopped down on her bed in the women's dorm. It 
was a week before the majority of the other students came back 
but she really didn't have any other place to go. Besides, it gave 
her chance to settle in after a long few months in Israel. She 
reflected back on her time there. On the whole she had enjoyed 
it but it had been soured by the tragic death of Steve. Her 
findings afterwards had helped to end things on a positive note 
but one thing she was sure of. It would be a hard fight to get her 
theories and ideas accepted by the scientific community.

She had had her final grades thru from Tel-Aviv and as she 
expected she had averaged 98.9% in every exam and 
coursework. Her reputation as a 'rising star' was now assured. 
That could only help matters when the time came.

In the meantime she had another couple of semesters here, 
even though she had done enough already to be assured a 
Ph.D. She only knew of one person who had passed a Ph.D. in 
less than two years and with two semesters to go but that had 
been in genetics and medicine and nearly thirty years ago. Dr 
Anne Baxter had a nice ring to it. She could leave now and be 
assured of that title but she had no desire to. She had too much 
to do and her dissertation to publish.

The flight over had been a long one and she was very tired. 
Tomorrow was only a few hours away and she still had to 
unpack. She closed her eyes and memories of her time in Tel-
Aviv came flooding back.

The plaques on the walls of every building dedicated to those 
who had died still had an effect on her. Men, Women and 
children had all been killed in that one fateful morning. It had 
triggered off a series of events that even now where trying to 
work themselves out. 

The joy she felt as the "Anna Maria" set sail on its research 
mission. Steve had been an unknown then, aloof yet good 
humored. She remembered watching the harbor move slowly 
out of sight as they went further and further out to sea until land 
was but a distant speck on the horizon. 

Her first dive gave her immense pleasure. It had been her first 
time using re-breathers and the freedom they gave her left her 
addicted for more. She had so wanted to see the sea life in all 
it's glory but empty sea greeted her on many occasions. The 
results of pollution and over fishing were having a catastrophic 
effect. In some cases she found it hard to tell she wasn't 
swimming in a pool, sometimes, so empty was the water. When 
she did find abundant life she never wanted to come up again. 

The day she'd had her idea and it had been confirmed in theory 
came back to her. Steve had been staggered by its audacity 
and stunned by its genius. Seeing the once aloof Steve melt into 
gushy admiration had given her a great deal of pleasure. That 
had been the day when they really started to hit it off.

Anne felt a cold twinge on her leg. It was as though she had 
bumped into Steve's body all over again. That was the low point, 
her lowest ebb for many years. Death seemed to follow her 
around, wait until she had dropped her guard, and then strike at 
those she had started to love and care for. Her swim to shore, 
dragging Steve's body behind her came into her mind. Why had 
she done something as stupid as that? The reason was simple, 
because she could.

Her victory over the Dean in getting re-assigned to the "Esau" 
gave her pleasure. That had been fun, from becoming an 
outcast to the most respected member of the crew in a scant 
two weeks was something of a triumph. The last month had 
been spent writing her dissertation, which was due to be 
published in a few months, and now here she was, alone again. 

In times likes these, when she was feeling tired and alone, she 
would just remember back to her childhood, and of the gleeful 
innocence of being a young girl. In her minds eye she saw 
herself, tiny and frail dressed in a blue and pink dress looking up 
in awe as they walked back from church one bright Sunday 
morning. She was a real daddy's girl at heart.

"Daddy, when I'm older I want to do what you do," she 
remembered saying. She must have been about five at the time.

"You'll have to work really hard to be a doctor," her father had 
told her.

"I don't need to work hard -- I'm clever!" She had stated with the 
absolute certainty that only a child can muster.

"That you are. But you still need to work hard. You know what 
the most important thing about being a doctor is?" Her father 
had bent down and was speaking to her face to face 

"No," she had whispered.

"Every life is unique and precious," Her father said.

"Like mommy's jewelry?" she had asked.

Her father gave a smile, "Just like mom's jewelry."

The image faded and it saddened Anne to think on it. How far 
she had come from that little girl looking up to her seemingly all 
knowing and all powerful father. Her love for him hadn't been 
able to save him that fateful night when the car he and her mom 
crashed while rushing to see her, had it?

There was so much she wanted to say to them. She knew they 
would be proud of her now, making a new life for herself, but 
what of the things she had done in order to get here? In the end 
that mattered little. She was who she was and where she was. 
No amount of reminiscing could alter that fact, and in a way it 
gave her the comfort she so desperately needed.

-- o -- o -- o --

The next two weeks were a nightmare for Mark. He had spent 
every waking hour studying in preparation for today, the day of 
his retest. Today would decide if he would be allowed to stay or 
would be drummed out in shame and failure. Wills had been 
shooed away and he lived, breathed and ate the topics of the 
exam. He didn't recall working this hard on anything in his entire 
life. He HAD to pass this course. As the old cliche went, failure 
was not an option.

He packed his bag, ready to drive to the room where the exam 
was to be taken. He wasn't allowed to take his PDA in, so he left 
it by the side of his bed. All he would be allowed to take in was 
himself, and some pens with which to write notes. He would 
speak the answers into the computer supplied, and it would then 
do the rest. He double checked the contents of his bag, uttered 
a silent prayer and went outside.

After rummaging around in his pockets and bag, he realized he 
had left his car keys behind and shot off back to his dorm to find 
them. After frantically searching around, he found them in an old 
pair of jeans.  Breathing a huge sigh of relief, he closed the door 
and ran back to his car and after a couple of attempts started 
the car. At least that bit was working well. Mark's car was an old 
1980's chevy. His friends called it antique, which it was and 
since the cost of gasoline had broken the ten dollars a gallon 
mark last year it was an expensive antique. The cost for Mark to 
change it to a newer fuel cell powered model was more than he 
could afford and gas prices being what they were he only used 
to for essential trips.

He had only just gotten round a sharp left handed corner when 
the car suddenly died on him and spluttered to a halt. Swearing 
violently he slammed his fist onto the steering wheel.  He looked 
around for anyone who might help him, but no one was around. 
He checked his watch; he had twenty minutes to go before the 
exam started. This was typical, just fucking typical.

He popped the hood open and looked inside. There was no oil 
or smoke billowing out so things looked ok from that angle. He 
checked under the car but again there was no fluid leaking out. 
He checked the battery connections but they seemed fine, as 
did the spark plugs. 

He heard a deep rumble in the distance. Actually it was more 
like a throaty roar of an engine. He looked up to see the outline 
of a silver Porsche take the corner he had just gone round with 
consummate ease. It just clipped the apex of the bend, and 
sailed around it as though on rails. Whoever it was, was a 
skilled driver. 

-- o -- o -- o -- 

Anne Baxter was relishing being back in her Porsche 
convertible. Months of driving boring modern cars with silent fuel 
cells and biometric sensors had robbed her of the feeling of 
power and domination that she felt while driving her Porsche. 
Although it wasn't her pride and joy, flew in the face of sound 
environmental doctrine she did have a soft spot for it. Everyone 
needs a harmless vice, and this car was hers!

She had just taken it out for an early morning run in the twisty 
roads, a few miles from her dorm. Before she had left she had 
upgraded it with the latest in anti-speed trap countermeasures, 
so she felt free to drive the car as it was supposed to be driven. 
There was a particular sequence of bends she had got just right, 
kissing the apex on each corner allowing the car to just feel it's 
way around each bend as if it were dancing. Even her favorite 
straight section was empty of traffic so she had allowed her 
speed to creep up to an indicated 170.  Creep wasn't the 
adjective she would describe it as, more like being hitting in the 
rear by a train. For sure, they didn't make fuel cell cars like this 
yet.

Her hair was all blown about by the force of the wind, it would 
need a wash before she went out again. She could feel her 
cheeks flush with the cool morning air. She was back into town 
now. All thoughts of high speed behind her as she cruised back 
to her dorm. As she rounded a bend she noticed an ancient 
chevvy, just like the one her dad used to have. It had the hood 
up and a man had his head inside the engine.

As she drew closer the man lifted his head of the engine bay 
and stared. He was obviously distressed about something, and 
she could see the start of a puppy dog look as he saw her drive 
closer. On impulse she decided she would stop to help, it would 
be her good deed for the day.

-- o -- o -- o --

As the Porsche drew closer, Mark managed to catch a glimpse 
of its occupant. It was Anne Baxter! That was all he needed. 
Late for an exam, covered in grease from trying to fix the car, 
and now his dream girl turns up to ruin his concentration. She 
was slowing down. What the hell was she doing? 

Mark had to try and stop his jaw from dropping, and his eyes 
from popping out of his skull as she drew along side him. Her 
hair was a mess, but even then she looked as heavenly as she 
had done since he'd first caught a glimpse of her all those 
months ago.

"You ok?" she asked.

Mark's reply was lost in the back of his throat. He dare not say 
anything in case it made him seem foolish.

She gave him an odd look, and then asked "Vous-etes bien?, 
Es usted aceptable? Sind Sie okay?"

Now Mark was even more nervous, she could speak at least 
three languages! All he managed to do was point at the car and 
say "car"

Anne gave a Mark the kind of look that implied his IQ was a little 
less than a turnip. She was about to drive off, when Mark in 
sheer desperation at seeing his dream woman leave forever 
said, "Sorry. I have the retake of my exam in fifteen minutes and 
my damned car has broken down. What a lousy day!"

Anne broke into a wide smile that caused Mark's heart to melt. 
She decided that Mark was just stressed about his exam, and 
that he wasn't going to harm her or anything, so she got out of 
her car.

"My dad used to have one of these," she said, noting that Mark's 
jaw was on the floor and his eyes were taking in her every 
curve. The thought pleased her. He was kinda cute in a boy 
next door sort of way. He reminded her of someone she had 
been close to so many years ago.

"Did he?" Mark asked. What a dumb answer he thought.

Anne walked over to Mark's car and peered in," Yeah it used to 
do this all the time. The wire connecting the ignition to the 
distributor used to slip out all the time. They look firmly 
connected, but they're not. Here let me show you," Anne pushed 
the four leads firmly into the distributor cap and then gave them 
a shove for good measure, " See you need to push until you feel 
them click back into place. Now try it." 

Mark dashed back into the car and turned the engine. To his 
amazement it started first time. "You don't know how much this 
means to me. Thank you. He checked his watch there was ten 
minutes to go but he would make it, just!"

Feeling elated that he wasn't going to fail just yet Mark blurted 
out, "I want to say thank you properly. Dinner at eight? Meet me 
outside the science faculty?"

Anne gave a smile. He was such an odd fellow. The similarities 
between rescuing this young man and the last man she'd helped 
whose car had broken down were not lost on her. Why not, 
second time lucky? "Sure. If you don't mind we'll take my car. 
Yours might not make it."

Mark was so surprised with her answer that he stalled the car.

-- o -- o -- o --

Elizabeth had arranged to meet Angela for lunch, and as usual 
Angela was running late. She checked her watch once more in 
frustration. She had a tutorial in half an hour, which didn't leave 
much time for lunch and a chat. Elizabeth was pleased that 
Deianeria had taken a back seat. In fact since she'd started 
back on the Olanzapine Deianeria had remained silent. It had 
been worthwhile running the simulation, even though it had 
gotten really spooky towards the end. Deianeria's revelation that 
the Children of Bexley were out to recruit her was, on the face of 
it not a surprise at all. What a coup that would be for them if they 
managed it. Well not any more they wouldn't!

She had told Angela the whole thing, except from the details of 
the deal she'd struck with Deianeria and about Deianeria 
herself. That would worry Angela too much. Angela had thought 
Deianeria's conclusions very logical and had promised to look 
out for her as well. So all in all no harm was done. 

Alex was due to visit in a week or so.  In spite of settling back 
into college life again, she found that she was missing him 
already. It was still a puzzle for her how she could miss 
someone she had spent years wanting as far away as possible 
after only dating them for two weeks. However, the fact 
remained that she now had an Alex shaped hole in her life. 
When she had told Angela about Alex she was delighted for her. 
When Elizabeth told her about their first date Angela went green 
with envy. Not only about the location but about Alex too. She 
was right, he was a prize catch. "Damn I knew I should've asked 
him out first!" Angela had commented.

The hardest thing Angela and herself had, had to do was to 
write to Nick's parents saying how sorry they were. The brutal 
way in which he had been killed had sent a shock wave thru the 
university, which was only now abating. Another shock for 
Elizabeth was to see that, unknown to her fifty thousand dollars 
had been transferred from her account, seemingly by herself! 
That must have been Deianeria! But what did she need the 
money for?  

Deianeria's activities whilst occupying her conscious mind, 
concerned her. Sure, she had indulged in a little 'two hand 
touch' before but Deianeria's had a dark, sinister edge to it. In 
her dreams she had vague pictures of raping and killing people 
she loved and cared for, but these were only a hazy recollection. 
She dismissed them as bad dreams. Another thing, why had 
Deianeria found it necessary to shut her out? The very act of 
becoming Deianeria confused her too. It was as though 
Deianeria thought her body was her own and not Elizabeth's, 
whatever happened to it happened to her. Still, it was a moot 
point now. Deianeria was safely contained, and where the hell 
was Angela?

She felt a tap on her shoulder and she whirled around, "Angela 
Hi. Where have you been?"

"I took forever at the dentist, and there was one hell of a queue 
at the drug store. Anyway I've got your 'asthma' medicine for 
you. I'm starved," Angela replied, breathlessly.

"Thanks for doing that for us. We should still have time for a 
sandwich before I need to go," Elizabeth took the small white 
box from Angela and put it in her pocket. Angela had played 
along with the Asthma medicine deception since she had first 
known the truth. 

"Still missing him?" Angela asked.

Elizabeth nodded, "Yep."

"Damn," Angela smiled.

-- o -- o -- o --

"Will's you'll never guess what!" Mark said running into Will's 
dorm.

"Who are you?" Wills asked with a smile.

"I've got a date!" Mark exclaimed.

"Who with? Lemme guess. Doris the cleaner!" Wills teased.

"With her! Anne Baxter!" Mark could hardly believe he was 
saying it, and even less that it was true.

"How come? You drug her or something?" Wills commented.

Mark couldn't contain his excitement. "You know I had my retest 
today. It was a nightmare of a morning. I was as nervous as hell 
and to cap it all, my car broke down on the way there. There I 
was stranded with nowhere to go but flunk city, when who turn's 
up in her Porsche. She knew exactly what to do to fix the car, 
and then when I asked her out as a thank you she said yes. It's 
tonight at eight!"

"She probably has a thing about men in broken down cars," 
Wills commented.

"I don't care. I'm dating Anne Baxter! Uber babe! I never thought 
there was god until now,"

"Never mind Uber babes how'd the exam go?" Wills asked.

Mark was too wrapped up in his thoughts to answer.

-- o -- o -- o --

As Anne walked up to the science faculty she wondered what 
the hell she doing going out with a guy she'd met on the side of 
the road. Still he seemed ok. She'd ran a check on his car's 
license plate. His name was Mark Andrews and he was a 
student studying ecology at the same college as she was. He 
had been brought up in Iowa and had been here ever since. He 
had no criminal record and was otherwise just a normal guy. 

He had seemed abnormally enamoured with her though. She 
wondered if she didn't have her own stalker and he was it. Oh 
well, she would find out soon enough. He was cute though, and 
maybe she was a sucker for helpless men. It had taken Steve 
weeks to pluck up courage to ask her out, and she'd only just 
said yes. So why did she agree to this guy? Maybe it was 
because he was just a name, if anything did happen to him, he 
was just a name, and that she decided was the way she wanted 
it to be.

She checked her watch, it read 7:59. Time to go. She had 
decided that casual was the way to go. Therefore, she had 
chosen her second best pair of skirt-pants, black shoes and a 
green blouse. Wrapping her hair up into a pony tail she made 
her way to the science faculty.

-- o -- o -- o --

"I hope this isn't going to be one of those flowers, restaurant and 
awkward moments when it's time to drop me off kinda date," 
Anne had stated mischievously. She had noticed Mark holding a 
bunch of mixed flowers as she walked up to him.

Mark looked dismayed, "Actually, these are for you," he said 
offering them to her.

Anne gave him a devastating smile, "Only teasing. How'd the 
exam go?" She took the flowers from him and held them under 
her arm.

Mark relaxed. He thought he'd blown it right away, but Anne 
joking with him had broken the ice and calmed his nerves. 
"Much better. It helps studying rather than mooching around."

Anne nodded, "That's the idea. My car's just around the corner 
So where are we going?"

Mark put a finger to his lips, and shook his head, "Wait and 
see."

"Aha one of those flowers, wait and see, and then awkward 
moments when it's time for me to go kinda dates," Anne gave 
Mark another heart melting smile.

Mark didn't really know what to reply. Was Anne mocking him, 
or was she trying to ease his nerves? "You go on a lot of 
dates?" He asked.

"Only with men who's cars have broken down," Anne said, with 
a grin.

-- o -- o -- o --

"If you park just over to the right there we can walk the rest of 
the way," Mark stated, gesturing to a small parking place about 
a hundred feet to the left.

"So it's a walk along the shore then," Anne commented. She 
was surprised how well she and Mark were getting on. He had 
responded in just the right way to her teasing, and had seemed 
to conquer his nerves that had threatened to mar the evening.

"Not just a walk along the shore. We need to eat as well 
remember, " Mark said. Anne was turning out to be as classy, 
witty, and beautiful as he had dreamed of. It wasn't every day 
that dreams turn out to be the same as reality, but today was 
one of those days.

"I don't recall any restaurants along here, unless of course you 
want us to walk 5 miles," Anne said. Whatever Mark had 
planned she knew she could cope with.

Mark gestured that they should walk down the long pathway 
onto the beach, "In about half an hour dinner will come to us!" 
He said, cryptically.

"Good I'm starved. As long as it's not sushi, when I was in Asia I 
ate nothing but sushi, got sick of it. Anyway, what part of 
ecology are you doing? Marine? Arboreal? Zoological?"

Mark raised an eyebrow. She wanted to talk shop. "Dunno yet. 
All of them I guess. You can't pick one without looking at the 
other. "

Anne nodded "True. Part of my time in Israel was spent looking 
at the marine ecology of the Med. It's such an enclosed space, 
it's an excellent barometer as to how things are going to 
eventually fail unless I stop it,"

Mark noticed the use of the word I. That was either supreme 
ego or she had found something. Anne didn't seem the 
egotistical sort, so it had to be the latter, "I?"

Anne gave Mark a wry smile, "Good try. I have an idea that's all. 
When I publish it'll be headline news."

"This looks about right," Mark gestured to an open stretch of 
sand just above the high water mark. He found a large, smooth 
stone and sat down beside it. He lifted it up and pulled out a 
large plastic bag. Opening the bag he pulled out several 
unopened bottles of beer and a bottle opener.

"Strange how people just leave food everywhere isn't it?" Anne 
commented and sat down beside Mark. The beer under the 
stone had been a nice touch. She took a bottle from Mark, as he 
offered it to her.

Mark decided that now was a good time to bring it up. He was 
desperate to know. "I'm sorry to hear about the boat accident. It 
must have been terrible."

Anne nodded. "Yeah it was. Poor Steve, never had a chance. 
That was the kind of celebrity status I didn't need"

"Sorry I asked. It was insensitive of me," Mark said. His heart 
sank. He had blown it again.

"That's ok. I now have to make sure I don't let his memory 
down. If anything, it's given me more impetus to finish the work 
we were doing. I had to go head to head with the Dean to get 
myself back on another boat."

Mark smiled, "That must have been fun."

Anne grinned, "yes it was," and she related the story of how 
she'd 'persuaded' the Dean to get her on board the 'Easu'

After the story was told Mark shook his head in disbelief "You 
said that!"

"And more," Anne said, taking another swig of beer.

Mark plucked up courage to say "You really are the most 
remarkable woman I've ever met. "
 

Anne raised an eyebrow, "How so?" 

"Apart from rivaling Rachel Martin,"

Anne gave a smile. "Why thank you."

"You act with supreme confidence. Nothing fazes you, it's 
though you own the world. You don't do you?"

"Do I look like Jennifer Gates? I hope I look better than Queen 
Britanny?" Anne commented.

"Thankfully no and you look a lot better than her!" Mark grinned.

"I guess it comes from having no parent's for much of your life. 
You either become bitter and resentful or you pick yourself up 
and make it on your own. I did the former, then came to my 
senses, and then did the latter," Anne said softly. Why was she 
opening up to Mark? Maybe, he just made her feel human 
again.

"I'm sorry. It must have been tough, "Mark said softly.

Anne paused for a moment, looking out at the sea. As if her 
heart was now lost in the midst of a million memories, "It is. 
Everyday I move a little further from who I was to who I want to 
be, but there are some hurts that time can't wipe away."

Mark couldn't recall seeing Anne looking so vulnerable. "Can I 
help?" He offered.

"I'm bad news Mark. Trust me, I'm more trouble than you can 
handle, more than anyone can," Anne said, still looking out to 
sea.

"How can you be? You don't even know me," Mark said. His 
dreams were slipping away fast. Was she going to leave him 
even before dinner?

"Yes I do. Country boy, setting out to the big city to make a new 
life for himself. I fell in love with a country boy like you once. He 
nearly didn't survive the encounter," Anne said quietly.

Mark looked at Anne's face and was amazed to see tears in her 
eyes. She was hurting inside and Mark wanted, no wished that 
he could take her pain away, "I don't care. You don't know me. 
I'm not this country boy you met once. I'm me!"

Anne turned to face him, her eyes full of sadness and despair, 
"You do not understand."

On impulse Mark took hold of Anne's hand "Then make me 
understand. I'll ask again what can I do to help?"

Anne was debating to leave or not but decided at the last 
moment to stay, "Dinner would be a start," she politely withdrew 
her hand from Mark's. It had been a nice gesture but was now 
obsolete.

Mark checked his watch, "He should be here by now" 

"Who should?"

"Bernito."

"That explains everything," Anne commented.

"Bernito makes the best hot dogs in the state. I've no idea what 
he puts in his relish but it's unreal," Mark said.

Anne gave Mark a look that said 'You dragged me all the way 
out here just for beer and hot dogs?'

Mark didn't need Anne to say it. He knew what she was thinking. 
But what was he thinking of; hot dogs and beer for God's sake! 
He should have blown his allowance on the most expensive 
restaurant in town. 

Anne saw Mark's glum look and burst out laughing. "Maybe I 
was wrong about you."

Mark felt hurt. More than hurt, cut to the core of his being. "I'm 
sorry I was wrong about you," he said softly. How could he have 
been so wrong? Anne Baxter, Uber babe! Yeah right! Uber Bitch 
more like!

"No you weren't. I told you I'm trouble!" Anne said. 

"And I'm just a country boy," Mark complained bitterly.

"Come here country boy," Anne said and to Mark's 
astonishment pulled him close and kissed him.

Mark was so startled he almost forgot to kiss her back.

-- o -- o -- o --

"Hmm what is in these hot dogs!" Anne exclaimed. The taste of 
the relish was nothing like she'd had before. Sure, some chili 
and tomato were in there, but she could only hazard a guess at 
the rest.

"Told you they were good," Mark said. He was still reeling for 
the shock of Anne kissing him.

"You're wanting to know why I kissed you, and will I do it 
again?" Anne commented.

"I had wondered," Mark admitted. Once again Anne had shown 
this habit of putting him off balance. Did she do that to 
everyone?

"Because you're you. I mean you could have taken me out to 
the most expensive place in town. Even though I knew it'd make 
you broke for a week. I've seen your car remember. You could 
have treated me like a princess; showered me with gifts in order 
to try and win me over, but you didn't. Tonight you showed me 
the real you. Not some false made up image, but the real Mark 
Andrews. This age of ours concentrates so much on what is 
image, what is false, it's wonderful to meet someone who's the 
opposite."

"I didn't plan it that way. This was all I could afford," Mark 
admitted.

Anne gave a smile. She was a little mystified as to why she'd 
kissed him as well. It seemed the right thing to do. She had 
found, much to her surprise that when she was with him her 
world weary cynicism melted away. It was though she was 
looking at things thru rose tinted glasses, that the past didn't 
matter, and that people or at least Mark Andrews felt trusting 
enough of her not to put up barriers. "I've told you what I'm like. 
More trouble than you can handle."

Mark was about to say 'Wanna bet?' but changed his mind at 
the last moment "You're probably right." He admitted

"But that's something I would like to be proved wrong on," Anne 
said softly.

-- o -- o -- o --

The next three weeks passed in a blur. He had seen Anne most 
days after classes, and it seemed that every day that passed, 
they had grown closer. Anne still remained secretive and 
mysterious about her past, so Mark avoided the subject. She 
would tell him when she was ready. So far he had seen little of 
the 'bad news' that Anne had warned him of, only that Anne was 
everything he had dreamed of and more. 

For Anne's part she was rapidly warming to her 'country boy'. 
Mark was incredibly laid back but he had a sensitivity about him 
that she found intriguing. She hadn't set out, when she came to 
college to find a boyfriend, in fact she had deliberately avoided 
the matter for a number of years. But Mark was different 
somehow. No matter how thorny she tried to be, he would just 
laugh it off and carry on caring for her. It was a strange situation 
to be in for sure.  Dare she love again? That was the question 
she asked herself again and again. What would happen if it 
failed like it had last time? Could she trust herself not to make 
the same mistakes again?

These were all questions that she didn't know the answer to. Did 
she even want to find out the answers in the first place? One 
thing for certain she did feel alone. "Hi-Fi track 16 personal 
collection". Anne sat back and listened to the music. It always 
helped her think.

        "I gotta take a little time
        A little time to think things over
        I better read between the lines
        In case I need it when I'm older

        Now this mountain I must climb
        Feels like the world upon my shoulders
        Through the clouds I see love shine
        It keeps me warm as life grows colder

        In my life
        There's been heartache and pain
        I don't know
        If I can face it again
        Can't stop now
        I've traveled so far, to change this lonely life"

A loud knocking at the door interrupted her thoughts. "Music,
volume down 95%." She called and answered the door. She broke
into a smile as she saw Mark standing there.

"Did you forget?" he asked.

"Nope I wanted you to come get me," Anne said with a grin.

"Nothing new there then. Everything packed and ready to go?" 
Mark asked. By now he knew it would be but he felt as though it 
was his duty to ask.

"We'll have to hire boards when we get there," Anne 
commented. She had been keen to get to the Florida keys for a 
while and now she had the chance she leapt at it. The fact that 
Mark was coming was a bonus. She hoped to get some diving in 
too.   This long weekend of theirs had been planned for a week 
or so now and she just hoped that she was right about Mark. 
Maybe it was time to open herself up to him?

"Did you get the exam results?" She asked expectantly.

"Sure did, I aced it!" Mark said and punched the air in triumph.

"Knew you would," Anne smiled back and gave him a 
congratulatory hug.

"If you hadn't have fixed my car..." Mark said

"If is such a big word," Anne commented.

-- o -- o -- o --

"You and Alex seem pretty serious. I can't keep you away from 
him can I?" Angela teased.

Elizabeth gave Angela a smile, "I have no idea what you're 
talking about." 

"Yes you do 'little miss, my boyfriend bought a house in 
Cambridge, just so he could be near to her'," Angela teased.

"That was so sweet wasn't it! It's strange how the more I get to 
know him as Alex rather than 'pain in the ass' the more I realize 
I was wrong about him. We just connect!"

"I still haven't forgiven you for getting in before me. He is soo 
cute," It had been a running joke that Angela was waiting in the 
wings should Alex and Elizabeth split up. The first time it 
happened, Deianeria had intruded telling Elizabeth to be careful, 
but Elizabeth just ignored it. Still, she was pleased to know that 
Deianeria still had her best interests at heart.

"No chance. Every time we meet, it's like we're bonding 
together. I never thought I'd say it but our lives are intertwining, 
becoming one. I can't imagine a future without Alex in it," 
Elizabeth swooned.

"Do I hear wedding bells?" Angela asked.

"IF and this is a big if he asked me I'd say yes. Oh Angela, do 
you really think he would?" Elizabeth asked.

Angela gave Elizabeth a hug "Don't ask me. If he's any sense 
he will. It IS romantic isn't it? Marrying your childhood 
sweetheart."

"He was hardly my sweetheart," Elizabeth paused for a few 
moments, "Angela Holden," Elizabeth said formally.

"Elizabeth Stephens," Angela replied.

"In the event of Alex and I getting married I want you to be my 
bridesmaid," Elizabeth gave Angela a huge grin.

Angela gave Elizabeth another hug, "I'd love to," she said 
tearfully.

-- o -- o -- o --

Mark and Anne had been an item for nearly four months, and 
Anne had to admit the time had simply flown past. She had 
enjoyed helping Mark on his course and his grades had 
improved noticeably. A few weeks ago, he had taken her to 
meet his parents, something that she was feeling a little nervous 
about. Not because she thought she would make a bad 
impression, but of what emotions it would stir in her. Much to her 
surprise it had gone very well. Mark's dad had loved her car, 
and his mom being captivated by her intelligence and 
conversation. 

Anne was now having a lay down on her sofa, and was reading 
the news on her PDA. Earlier on, she had moved some money 
around to her various accounts, so that she could to maximize 
profits from an up turn in the futures market. On a whim, she 
turned to the celebrity section of her personalized news-mail. 
One article in particular caught her attention right away.

"Mr and Mrs Stephens are delighted to announce the 
engagement of their daughter, Elizabeth to Mr Alex Richards, 
son of Cathline Richards(Rachel Martin).

Mr and Mrs Stephens of Fury fame had been staying at their 
island mansion in the Maldives when the news broke. Elizabeth 
is currently in the middle of a medical degree at Cambridge 
University, England and it is understood that the wedding will be 
after she has completed the course. "

Anne gave a broad grin, "You go for it girl!"

Her PDA interrupted her reading "Anne, it's time to go. You are 
due to meet Mark at the Theatre in half an hour."

"PDA, thanks." Anne commented. She had been looking forward 
to this for days. Although it was only a local production, it had 
been highly rated in the local newspapers, and besides, in these 
days of interactive on demand TV it was a refreshing change to 
watch something live. 

Anne checked her watch; she still had a little time to work on the 
final details of her paper. It should be ready in a month or so, 
and she had now manufactured enough plankton to show the 
principle to any that would doubt her. She still hadn't shared her 
idea with Mark. It was better he didn't know; the ecologists 
would have a fit if they found out. They would do sooner or later 
of course, but by then the facts would be out. She had speeded 
things up, as Mark's research and others from around the world 
showed the rate of environmental decline was not gradually 
declining. The recovery was normally helped by compensation 
mechanisms within the ecosystems, but was now snowballing 
out of control. These compensation mechanisms, such as the 
increased growth of algae that would then decrease the amount 
of CO2 were now past breaking point. Gaia had given it her best 
shot, but under increasing population and industrial pressures it 
was a one way battle. By hers and Mark's best estimates they 
had less than sixty years before the ecosystem of the ocean's 
collapsed. In ecological terms that was no time. If they didn't act 
in the next two years or so it would be too late.  Thanks to the 
ark project the DNA of many species had been preserved after 
their extinction. So some of the bio-diversity could be regained 
in time but what good would it be if they had no habitable 
environment to live in? Mankind would of course adapt. Already 
they had the technology to compensate for the lack of Oxygen 
in the atmosphere, but building these O2 re-circulation plants on 
a global scale could take decades. That wouldn't prevent the 
extinction of thousands of species in the meantime. She had to 
succeed! The alternative was for mankind to live in domed cities 
with regulated air, not being able to go outside for fear of sun 
burn, and a landscape almost devoid of vegetation. Two 
hundred years from now the Earth would be a wasteland.

Her thoughts were interrupted by a knock at the door. Was it 
that time already? She opened the door, and gave a smile, "Hi 
Mark. Ready to go?"

"Sure," Anne said, and closed the door behind her.

Half an hour later Anne had parked the car "We'd better get a 
move on. It starts in 5 minutes," Mark said.

"Yep. We'll cut thru there," Anne said pointing towards a small 
side alley. 

"Ok," Mark said, and hand in hand they sped off.

On reflection this was not a good idea, Mark decided. The back 
alley was dimly lit and the walls were sprayed with various 
graffiti tags. Several large trash cans had been tipped over 
leaving paper, food and everything else sprawling all over the 
road. "We'd better hurry," Mark hissed, and they started to run 
faster.  

Suddenly two figures loomed in front of them barring their way. 
In the dim street lights Mark could just make out an some kind of 
emblem of their black leather jackets. In unison Mark and Anne 
turned to leave back the way they had come, but another figure 
was blocking their path. Mark had a sinking feeling in the pit of 
his stomach. "Hi guys what's going on?"

The lead figure stepped forward, his face masked by a red silk 
scarf. Mark's fear rose as he noticed a large looking hand gun in 
the man's hand. He glanced across at Anne, who much to his 
surprise wasn't looking scared at all. She was glancing around 
as if calculating options. Mark moved across to put his body in 
front of hers. He had to protect her at all costs!

The lead figure looked firstly at Mark, and then at Anne "Ok 
here's how it goes. You give us your money, and the keys to 
that nice Porsche you were driving, and we'll let you go."

"Not my car," Anne complained and moved to face the gang 
leader. A move that put her in the firing line instead of Mark.

The gang leader leered at Anne. "I've just added something 
else. Let me have a go with your girl as well!"

Mark moved forward to try and pull Anne out of the way, but one 
of the other gang members pulled another handgun and pointed 
it at his head.

Anne tried to placate an already tense situation, "Hey look, I 
don't want any trouble. Mark give him what money you have I'll 
go with him." 

Mark couldn't believe what Anne was saying. She had refused 
to sleep with him, saying she had wanted to wait, and now she 
was going to go with some scum instead. "Over my dead body!"

"Mark, Please I know what I'm doing!" Anne hissed. There was 
something in her voice that made Mark sure she had something 
in mind.

"You heard your girlfriend," the gang leader leered.

Grudgingly Mark reached into his jacket pocket and pulled out 
his wallet. He threw it to the ground. Still being covered by 
handguns the gang leader picked it up, and said, "Thanks. Have 
a nice day."

The gang leader then moved in and gave Anne a large kiss. He 
held her head firm as he pressed his lips against hers. She 
managed to break free and said "Not here. There!" She pointed 
to a side alley a little way to the left.

"Anne!" Mark called and tried to stop the gang leader. He felt a 
large thud on the back of the head and fell to the floor dazed.
"Next time it'll be a bullet," one of the gang members snarled.

The gang leader led Anne at gunpoint to the side alley. When 
he was sure he was out of sight he pointed his gun at her and 
demanded "Strip! Bitch"

Anne's tone of voice changed to a deathly whisper "My name is 
Anne Baxter and I am the last living thing you are ever, ever 
going to see!"

The gang leader gave a loud laugh "Yeah right,"

Anne raised her left arm and said "Watch"

The gang leader was amused at this young woman's bravado. 
She was no match for him both physically, and he had a gun. 
What could she possibly do to him? There was something in her 
tone of voice that worried him. It was as though death had 
spoken thru the voice of this young woman. His worry turned to 
fear as he saw the flesh on the woman's started to shift. In a 
matter of seconds her fingers had fused together to form a 
sharp serrated bony blade. The bone traveled down until it 
reached her elbow. Now her whole upper arm was a nasty 
looking serrated blade. The gang leader gave a smile, no matter 
what this woman was she was no match for a magnum.

Mark screamed as two shots rang out "ANNE!" 
Seconds later a blood curdling scream came out of the back 
alley.

Inside the Alley Anne concentrated and the bullet wounds 
healed up with in a few moments. She pulled her blade arm 
from out of the sternum of the gang leader. She concentrated on 
her arm and the flesh reformed back into her hand once more. 
Now it was time to deal with the other two punks. She now knew 
that it was too late for Anne Baxter. As soon as she walked out 
this Alley, then Mark would start asking questions. Although 
there were no signs of the bullets on her body they had left two 
rather large holes in her blouse, and the small amount of blood 
that had seeped out before the wounds had sealed, had left tell 
tale stains. She had a decision to make and quickly. Mark's life 
was still in danger. If she disappeared now, then it would be a 
number of years before she could resume work on saving the 
oceans. She didn't have a number of years left before it was too 
late so really there was no choice at all. She hoped Mark would 
understand. For a fraction of a second she considered killing 
him as well. There was the perfect alibi, but in spite of 
everything she'd done before she couldn't bring herself to kill an 
innocent man, especially one she had grown close to over a 
number of months.  'It had to happen one day' she thought, and 
walked out of the side alley.

Mark was still hurling obscenities at the rest of the gang when 
Anne walked out. Mark caught a glimpse of her walking calmly 
out and called out "ANNE! You ok?"

The gang member behind Mark shouted at Anne "Where is he 
Bitch!"

In an icy cold tone that chilled Mark to the bone Anne replied, "I 
killed him and you two are next."

"Wanna bet?" The gang member said and fired two shots at 
Anne.

"Anne!" Mark screamed as he saw her stagger backwards as 
the bullets struck her." 

To Mark's amazement Anne kept coming. She was now moving 
faster than his eye could detect. He heard a gargled, stunted 
scream and the gang member guarding him collapsed in a 
heap, his head nearly decapitated from his body, and blood was 
pouring from an open neck wound.

The other gang member turned to flee but to he found his way 
blocked by someone who looked like Anne. Both of the 
creatures arms had been turned into serrated blades, and it's 
head although resembling Anne was coated in bony armor. 

"What, What are you?" the remaining gang member stammered.

The figure said in a voice straight from death it's self. "My Name 
is Dr Elizabeth Anne Bexley and I am the last living thing you 
are ever, ever going to see."

Before the gang member could react the creature that had been 
Anne rammed both her bladed arms into his chest and ripped 
them outwards, nearly tearing him into two.

This was too much to Mark, still dazed from the blow to the head 
he collapsed to the floor in a faint. 

-- o -- o -- o --

"Hey Angela you in there? The lights don't seem to work" 
Elizabeth called into her darkened apartment. 

Elizabeth walked inside. There was a green light LED showing 
from the TV, so that meant there was still power in the room. 
Light's didn't just fail There was something wrong!

A tingle of fear trickled down her spine as she walked into the 
living room. There was nobody there. She waited for a few 
moments to allow her eyes to get accustomed to the dark before 
venturing into the kitchen. She stumbled as she walked into the 
Kitchen and managed to keep to her feet. She turned around to 
see what it was and gave a loud scream as she saw Angela's 
body lying on the ground. 

Instinctively she felt for a pulse and breathed a sigh of relief. 
The pulse was strong, but Angela had obviously been sedated. 
Her PDA was still in the living room table and the police were 
only minutes away. She walked back into the living room and 
tried to see it in the darkness, "PDA ALARM!" she called loudly, 
and desperately waited for the beep of confirmation, but none 
was forthcoming. Suddenly she was grabbed from behind and 
felt a damp, sweet smelling cloth go over her mouth. Seconds 
later it all went black.

-- o -- o -- o --

Mark awoke an indeterminate time later. He felt a cold, wet cloth 
soothe the bruise on his head. He opened his eyes to see Anne's 
face looking down at him. Her blue eyes looked at him with 
concern. "You should be ok. There's no concussion."

"Where am I?" Mark asked woozily.

"Your place," Anne said softly.

"You, You," Mark started to say. The visions of Anne or 
whomever she was cutting down the gang in front of him filled 
his mind. To think he had loved her!

"They shouldn't have tried to take my car," Anne said, with a 
smile.

Mark managed to sit up. How could she make light of killing 
three people in such a brutal manner?

"Here take this," Anne said, and gave Mark a strong, sweet cup 
of tea. She moved over to the far side of the room, swung an 
armchair around, and sat in front of him.

"Thanks," Mark managed to say. All he could think of was the 
sight of the near headless body of the gang leader collapsing in 
front of him. 

"I expect you have a million questions. Let me start. Who am I? 
How did I do what I did? And what's going to happen to us?"

Mark managed to nod "Those will do for a start," He took a swig 
of tea and felt a little better.

Anne gave a deep breath. This was going to be hard as it was, 
"The name I was born with is Elizabeth Anne Bexley. I was born 
in 1969 to Margaret and Dr William Bexley. I obtained a medical 
degree at Harvard in 1994 and worked for a time in my father's 
hospital."

"No you can't be, you're dead!" Mark stammered. His heart felt 
as though it had been ripped apart. Anne his dream woman had 
turned out to be a monster! But what would she do if he dumped 
her? His dismay turned to terror.

"I told you I was more trouble than you could handle," Anne 
commented.

"The world saw your body," Mark tried refute the story of the 
woman in front of her. Anne had to be teasing, the alternative 
was too horrific to contemplate.

"The world saw a body, not mine," Anne said softly. She had 
noted the look of terror on Mark's face. She knew this would 
happen.

"Tell me about it, all of it. How you felt, why you did what you 
did. Please, I need to know," Mark averted his gaze as he said 
it.

"What's to tell? You know the truth. Cathline wrote it all down," 
Anne commented.

Still not looking at her Mark asked "I read it years ago, anyway, 
She didn't write down what you felt, how you feel now. Am I in 
danger?"

Anne gave Mark a look of concern "Why should you be?"

"Because If I dumped you you'd do to me what you did to 
Matthew Stephens."

"Do you know how long ago that was? Nearly twenty five years 
ago. You want to hear things from my point of view, fine. I hope 
you have all night."

Mark turned to face Anne "Elizabeth, Sorry Anne. I loved you. 
Maybe I still love you. I dunno how I feel at the moment. If I am 
to trust you I have to know first hand. 

"Ok. Here goes. You ever been hurt so badly you felt as though 
you wanted to die? Felt betrayed and embarrassed so much 
that the only way clear was to end your life?"

"Not until tonight," Mark said softly.

"Well that was how I felt. I nearly killed myself after Matthew left 
me, but my mom caught me just in time. They knew that I 
needed a change of scene to help me get my mind away from it 
all. The last straw came when I tried to save a small girl, but 
failed. Mark, I ought to have saved her but I felt too distracted to 
concentrate. She died because I was hurt. She was the first of 
the people I killed," A tear formed in Anne's eye. It had been 
years ago but the pain was still there.

"You can't blame yourself for that! She could have died 
anyway!" Mark tried to sound comforting.

"I thought that at first, told myself that when I woke up in the 
night crying for that little girl. I had to tell her parents Mark, I'd 
done it before; it goes with the job but this was different. If only I 
didn't feel like I did I would have seen the embolism that killed 
her."

"Did anyone else spot it?" Mark asked.

Anne shook her head "No. But my instinct told me it was there."

"I think you were punishing yourself because you thought it was 
your fault Matthew left you." Mark commented. 

"Maybe. Anyway, I was fine until I saw Matthew with Kat after 
they had been to the cinema. It was strange; it was as though I 
had been taken over by a different person. My normal morals 
went out of the window until all that remained was the person 
who called herself 'Lizzy'."

"You mean you were possessed? That's a bit from the dark 
ages isn't it?" Mark commented.

"No not possessed. As you may remember I had a flaw in my 
brain. It made me susceptible to MPD. Lizzy talked me into 
letting her get her own back on Matthew. Eventually as time 
wore on there was no more Elizabeth, only 'Lizzy'. Sure, I was at 
the back of her mind screaming to get out, but it was like being 
in a sound proof cell. The thing was, Lizzy was so much cleverer 
than I was, she was able to work things out, plan things and do 
things I never even dreamed of."

"So this 'Lizzy' became your dominant personality?"

Anne nodded "I was consumed by hatred. Nothing mattered to 
me except exacting my vengeance on Matthew and Kat. People 
were just tools to use and toss away. What did one life matter? 
What did a million? Any price was worth it to get back at 
Matthew," Anne stopped to wipe away the tears forming in her 
eyes.

"Is 'Lizzy' still around?" Mark asked worriedly.

Anne shrugged "Who knows? But I doubt it. As soon as I 
realized what the problem was I took measures to cure myself. It 
took me a few years to work it out but using my changeling 
organ I cured the flaw in my brain. I'm cured, permanently."

"Sorry, carry on with the story," Mark commented. As horrified 
as he was, the whole thing fascinated him.

"Anyway you know what happened after that. I had Jane 
kidnapped, Cathline too, and took Jane's place in time to see 
Matthew just changing into me."

"What did it fell like?" Mark asked. By now he was intrigued.

Anne replied I wrote down what it felt like in my journals

        'You can't brush me under the carpet, you can't hide me 
        under the stairs. The custodian of your private fears, your 
        leading actor of yesteryear, who as you crawled out of 
        the alleys of obscurity, sentenced to rejection in the 
        morass of anonymity.

        'You who I directed with a lovers will, you who I let 
        hypnotize the lens. You who I let bathe in the spotlight's 
        glare. You who wiped me from your memory like a 
        greasepaint mask, just like a greasepaint mask.

        'But now I'm your snake in the grass, the ghost of film 
        reels past.

        I'm the producer of your nightmare and the performance 
        has just begun, it's just begun..."

I felt elated. All the work I had put in over the past few years had 
come to fruition. It was nothing like I have experienced before or 
since. I saw Matthew's legs had become my legs. Their long, 
slender shape was just visible under his pajamas. I knew from 
tape records how he'd screamed in horror as his legs had 
changed one after the other, and then pain he felt when the 
withdrawal symptoms of the drug I had invented took effect. 

I walked in and saw his body start to reshape. His normal 
muscular hairy chest flattened out, and the hairs retracted back 
into his body. There was a crunch of bone as his rib cage 
rearranged it's self and his stomach almost caved in to form a 
copy of my female one. He looked odd laying there, a collection 
of male and female. His round shoulders and collarbone looking 
as though all he needed was a pair of tits. Of course he had 
much further to go but it was then I knew I had done the right 
thing."

Anne's matter of fact tone chilled Mark to the core "You sound 
as though you are proud of what you did."

Anne noticed Mark's fearful look. "I was. Still am really. Re-
writing the laws of nature was some feat. It wasn't me who did it 
of course. 'Lizzy' was able to do it in months, where I would 
have taken years. I am proud of what I achieved, not the results 
or the motive. I caused years of misery and I'm not proud of that 
at all. How much more do you want to know?" 

"All of it," Mark said softly.

In a way Anne was relieved. Speaking about what she had done 
in the past helped exorcise some of the ghosts she carried 
around with her. In telling Mark, someone who'd she'd only just 
got to know she found it releasing. As if burdens she had carried 
around for years could now be shared. But did Mark still want 
her? More to the point did she still want Mark?

Anne continued, "I learned he had taken two more pills. I don't 
know if you remember, but that was how the drug was being 
administered. Anyway, It wasn't until a few hours later I heard a 
scream and came running into the bathroom. His hips were 
reforming in front of me. They became smaller and much 
rounder. He bent double as his womb started to form inside of 
him, and he turned around to look at his ass rapidly becoming 
more and more feminine.  I had such a cute ass too. He stood 
up and surveyed his new body. He now had my curves and 
looked every bit the woman he was becoming. He took 
particular note of the way his public bulge merged into his flat 
stomach. All the time I was feeling elation that it was working, I 
felt no pity and no remorse for him. 'Lizzy' was utterly ruthless in 
that regard."

Mark drank the rest of his cooling tea. Hearing Anne talk like 
this, so matter of fact and so dispassionate only served to make 
him more wary of her. 

"I know what you're thinking. How can I talk so coldly about 
ruining a man's life? The answer is that it was all a long time 
ago, sure I feel sorry for what I did, but I put it right again. Mark, 
that's the important thing I put it all right again."

"What happened next?" Mark asked

"You're determined to drag everything up again aren't you. I've 
had over twenty years to deal with this." Anne commented

"And I've had twenty minutes," Mark replied.

"Listen I don't owe you anything! I could have just vanished 
without a trace back there. I made a choice to reveal myself to 
you. I hoped you'd understand, maybe I was wrong," Anne said 
softly.

Mark shrugged his shoulders in desperation "I'm trying to 
understand, but to do that I need to know everything. No 
secrets, no masks and nothing left out. You need to do this as 
much as I need to hear it!"

Anne had to admit Mark had a point. She was finding this 
releasing "Anyway on with the story. His arms changed from 
muscular manly ones to my delicate and slender ones. We had 
an argument on what to do next, and I walked out him leaving 
him to suffer on his own for a while. When I returned a day or so 
later he now wore my face and had grown a pair of tits. He was 
now a woman save one place, his dick. I persuaded him to fuck 
me knowing full well that by the morning his cock would become 
a vagina. I wanted the pleasure of making him fully female 
myself. You know the rest of the story after that."

"How did it feel killing all those people, ruining all those lives?" 
Mark asked.

"It felt good. Every time I killed or maimed someone 'Lizzy' 
became pleased. The knowledge that Matthew and Kat's 
marriage was wrecked, and that Cathline was now alone gave 
her great delight. I was all set to live out my life as Rachel Martin 
when my parents were killed in a car crash. If Matthew jilting me 
was the trigger than this was the cannon shell. My anger at him 
grew daily, I saw it as his fault they had died. I was determined 
to see him hunted down and killed. My fury grew in intensity until 
it consumed me totally. 'Lizzy' swamped my mind. She was 
Elizabeth Bexley, the old me, the compassionate me had long 
been disposed of and only 'Lizzy' remained. It wasn't until my 
final battle with Kat that my fury began to fade"

"When you were a mermaid right?" Mark asked.

"Yeah. That's why I love the ocean so much. The time I spent in 
exile there calmed me. I saw things you wouldn't believe. Shoals 
of silver side fish turning as though one large super-organism 
forming flashes of silver lightning underwater, twisting and 
turning forming impossible colors. I saw where sharks go to die, 
ship wrecks that were monuments to man's folly. I now longer 
saw it as exile; it was a blessing. It remained that way until the 
Guild caught me. When I was in captivity I was able to rid myself 
of 'Lizzy', and finally get the real me back. It took me months of 
soul searching and thanks to medical treatment she was gone 
forever."

"I read about that in Cathline Richard's book."

"Most people have," Anne commented. They were now coming 
onto the most painful part of all.

"Did you use your changeling organ to kill those gang 
members," Mark asked fearfully.

Anne nodded, "What happened after the Fury directive will 
come later, but yes it was. It enabled me to shrug off the bullets, 
move faster than most people can see, and shape my hands 
into razor sharp weapons."  

Mark remained silent. He had never seen anything like it. Anne, 
his beloved Anne, had ruthlessly killed with extreme prejudice 
those who had sought to harm them. The gang members never 
stood a chance. His mind flicked back to the image of the final 
gang member nearly being torn in two.

Anne continued. "You have no idea what it felt like when Tel-
Aviv and then Cairo were destroyed. I had felt elated again that I 
had saved Tina Cox's life, but the death of fourteen million 
people wiped that out right away. That was the hardest time of 
all. I still have nightmares about what my mistake cost. They 
haunt me Mark even after twenty years, and nothing I can do 
can wipe away the screams."

"What happened after that, after you defeated the Guild," Mark 
said trying to ignore the fact that Anne was now crying softly. He 
needed to press on. To find the answers both he and she 
needed.

"I met with the vice president, actually he was the president in 
all but in oath. I needed to be sure my future was safe. As I 
remember it the conversation went something like this.

        I asked him  "When this is over I want three things."

        The Vice President replied.  "Which are?"

        As casually as I could muster I said, "I want a full pardon.  
        I can't live my life as a fugitive, hated and despised by all.  
        I want all charges against me dropped."

        The Vice President had expected something like that, 
        "Now wait a minute.  You haven't just knocked over a 
        drug store and ran away with a few cigarettes.  You're 
        responsible for the murder of eighteen people, 
        kidnapping, and crimes against humanity.  I can't just 
        wash over all that and let you go."

        "Fine, you sort this mess out," I stood up and turned to 
        go. I knew the vice president had no choice but to agree 
        to my terms.

        He thought for a few moments and then had an idea, "Ok 
        I'll pardon you on one condition."

        "Which is?" I asked

        "You're intelligent, work it out.  After you've done that, tell 
        me your decision," The Vice President said."

"So what was his condition?" Mark asked.

"That I spent a period of time working for the government. My 
changeling abilities were far too useful to just let run loose. It 
also enabled them to check if I was really cured. Using a sample 
produced from my DNA Machine before they blew it sky high 
they turned a secret service guy into a copy of Rachel Martin.  
He committed suicide in my place. It was that body that Matthew 
and Kat saw, and that body that was buried next to my parents 
in New York. I stood and watched them do it. I wrote the note 
and left all my belongings behind for them to clear up."

"I thought an autopsy proved it was you," Mark said.

"It proved that the body had a unique make up, not that it was 
me. Matthew, Kat and Cathline believed it was me at the 
hospital. They even signed the identification forms and 
everything to say so. Therefore to all the world I was dead."

"So A guy died so you could go free?" Mark asked.

Anne nodded, "He was keen to do it, or so I was told. Wanted 
to give his all for his country. His family can be assured his, 
sacrifice saved a lot of lives. Anyway, I worked for the CIA for 
fifteen years as their number one courier. My ability to infiltrate 
into anywhere, and escape unseen was critical to the success of 
a number of government operations. I smuggled plans for a new 
Chinese missile out from Beijing, underwent scouting missions 
for counter terrorist strikes, helped smuggle that Russian doctor 
out from the new USSR, and everything in between. They even 
gave me a codename, 'Friday'."

"Friday?" Mark queried

"It came from a Robert Heinlein book about a genetically 
engineered woman who was the government's number one 
courier. Anyway I was 'Friday' for fifteen years. After my time 
was up they gave me some money, well a lot really, and a new 
identity. I used my changeling organ to turn myself into 
Elizabeth Anne Baxter, and start a new life here."

Mark had a revelation, "So that's how you survived the boat 
wreck!"

Anne nodded, "Yep. A forty mile swim is no distance at all for a 
mermaid, neither are sharks or currents. I dove deep to avoid 
detection, and landed just where I would have if I had really 
used the currents. It was a stupid thing to do. I should've just 
waited around for help."

"And it was all going fine until tonight!" Mark said bitterly. How 
had he fallen for this inhuman monster? Remorse or not she 
was still a killer at heart.

Anne nodded "I know. Mark I had no choice but to kill them," 
She had detected Mark's face drop once more, and knew what 
he was thinking.

"Didn't you? You could have stunned them. Still mercy isn't your 
style is it?"  Mark said bitterly.

Anne's voice became angry "Hey time out!! I don't just kill 
people on a whim. If there was any other way I would've taken 
it; but there wasn't! Look! I've just told you stuff that nobody 
knows but you and me. Ok, if I'd have stunned them they'd have 
told the cops that they'd shot me four times, and that I still kept 
coming at them, and my cover would be blown. If I had faked 
death they would have killed you. Maybe I did overreact, but 
when people I love are in danger I do whatever I need to protect 
them."

Mark was staggered "Love?" Anne had just admitted she loved 
him. 

"Yes love. Why the fuck do you think we're still going out after 
four months, when my every instinct was to run away? It wasn't 
your cooking that's for certain. You make me feel me again. I 
haven't felt the real me for nearly thirty years!" Anne snarled. 

Yesterday Mark would have felt elated, as though he had just 
won the state lottery, but now he just felt numb. The woman he 
loved was in fact Dr Elizabeth Bexley!" I need some time to 
think."

"I thought you loved me?" Anne said softly

My God, what have I said? Mark thought, "I can't end it with you 
can I? You'll come after me, like you did Matthew."

Anne stood up "After all I told you, you still think that? Then 
there's nothing more we can say to each other. I thought you 
loved and trusted me, guess I was wrong. Goodbye Mark."

Anne walked out leaving a tearful Mark behind. 

-- o -- o -- o --

Still sobbing Anne ran to her car and drove to her dorm. She 
could partly understand Mark's dilemma but if he truly loved her 
he would put that to one side wouldn't he? She opened her door 
and ran inside. She was so upset she could hardly walk and she 
collapsed onto the bed. "Hi-Fi track 20 personal collection"
She buried her head into her pillow and cried like she hadn't for 
nearly thirty years.  Once again her one chance of happiness 
had been dashed because of who she was.

        "The world was on fire
        No one could save me but you.
        Strange what desire will make foolish people do
        I never dreamed that I'd meet somebody like you
        And I never dreamed that I'd lose somebody like you

        No, I don't want to fall in love
        [This love is only gonna break your heart]
        No, I don't want to fall in love
        [This love is only gonna break your heart]
        With you
        With you

        What a wicked game you play
        To make me feel this way
        What a wicked thing to do
        To let me dream of you
        What a wicked thing to say
        You never felt this way

        What a wicked thing to do
        To make me dream of you
        And I don't wanna fall in love
        [This love is only gonna break your heart]
        And I don't want to fall in love
        [This love is only gonna break your heart]

        World was on fire
        No one could save me but you
        Strange what desire will make foolish people do
        I never dreamed that I'd love somebody like you
        I never dreamed that I'd lose somebody like you

        No I don't wanna fall in love
        [This love is only gonna break your heart ]
        No I don't wanna fall in love
        [This love is only gonna break your heart]
        With you
        With you
        Nobody loves no one."

-- o -- o -- o --

The phone ringing beside Matthew woke him up. "What the 
hell!" he muttered. The bedside clock said 4am. He let it ring for 
a few more moments, hoping whoever it was would hang up, but 
to his annoyance they didn't. Groggily he picked it up "Hello"

"Is that Mr Matthew Stephens?" The voice had an English ring 
to it, but Matthew couldn't place the accent.

"Yeah," Matthew muttered.

"My name is inspector Alan Jones of the Cambrideshire 
constabulary.  I have some bad news for you, I'm afraid. It's 
about your daughter, Elizabeth." Matthew's blood ran cold. The 
fear that haunts every parent rippled thru him in an unstoppable 
tide.

"What is it? Is she ok?" Matthew managed to say.

"I'm afraid she's been abducted. She didn't turn up for her 
lectures this morning, and her fiancée found her apartment had 
been ransacked and she was missing."

Still in a dazed state, it took Matthew a few moments to take it in, 
"Do we know anything else? If' it's about money?"    

"We don't think it's about money. They would have left a 
demand or instructions if it were." Alan said softly.

"So how do we play this?" Matthew asked, now starting to get 
his mind in gear.

"We wait for them to contact you. I would suggest one of you 
waits there, and the other flies over to be with us. That way we 
get all the bases covered. Alex Richards is here helping us."

"But we're nearly a whole day away. Anything can happen in 
that time. Can I speak to Alex?" Matthew complained. 

"Give me a few moments," Alan said.

A few seconds later heard Alex's voice. It sounded tired, worried 
and fearful, "Hi Matthew," was all he could bring himself to say.

"Alex are you ok? You sound awful," Matthew commented.

"I'm sorry Matthew. I tried to look after her for you. If only I had 
been there. Why'd they take her Matthew she hadn't done 
anyone any harm?"

"Did her room mate see anything?" Matthew asked. He hoped to 
divert Alex's self pity into something more constructive. 

"Angela? She's gone too. Matthew I'm so sorry," 

Matthew could hear that Alex was trying to fight back the tears. 
"It's ok. Nobody blames you."

"Thanks but when she's safe then I'll be happier. Inspector 
Jones wants to speak to you. I'll hand over to him in a sec. Tell 
mom for us will you? I hate being alone out here."

"I will," Matthew promised.

"Hello Mr. Stephens. We do have one lead, which we are 
investigating at the moment. We have contacted the FBI and 
interpol with this lead. I promise you we will do our utmost on 
this

Kat gave a yawn and opened her eyes. She saw Matthew's 
worried face and saw the phone against his ear "What's up?"

Matthew indicated Kat to be quiet and then answered "What's 
the lead?"

"I'd rather not say at the moment, but it looks a good one. Look, 
the best thing you both can do is remain calm. Over eighty 
percent of abductions turn out just fine. Trust us, we know what 
we're doing. My number is in your phone's memory. Call us if 
anything happens at all."

Still in shock Matthew replied, "Thanks Inspector we'll be in 
touch," Matthew put the phone down gently.

"What is it?" Kat demanded.

Matthew took a deep breath, hardly believing it himself 
"Elizabeth's been abducted. It happened last night they think!"
 

Kat gasped "No. Please God!"

"Whoever did it left no note, no ransom demands or anything. 
She's just gone!"

"Poor Alex he must be beside himself. I'll go," Kat said.

"I'll tell Cathline," Matthew said.

-- o -- o -- o --

Anne woke up at midday. In the stark light of day her situation 
hadn't gotten any better. She didn't blame Mark for the way he 
felt. It was understandable in a way. Not only had she deceived 
him, she had scared the crap out him with her summary 
execution of the gang. Didn't he understand that she would do 
anything to preserve the lives of those she loved and cared for? 
That taking the gang down because they threatened them both 
was an instinctive reaction from her?  In fifteen years of working 
for the CIA she had been trained to act on instinct. If you didn't 
you were dead, and so were those you were trying to protect.

She suspected it wasn't only what she'd done to the gang that 
bothered Mark; it was who she really was. Sure, it had been 
twenty years, but some things refuse to die even after that 
amount of time. Now she was trapped. To run away and hide 
would mean that time would run out for her idea and therefore 
the oceans. To stay would mean facing up to Mark and the 
consequences of telling him the truth.

Maybe that wasn't such a bad idea? She had spent the last 
thirty years running away from herself. Firstly, in her own mind, 
and then as Anne Baxter. But was Mark the one to run towards 
rather than away from?

The phone ringing interrupted her train of thought. Hoping it was 
Mark she dashed to it "Hi."

A cold voice with an indeterminate accent answered "Friday, 
This is Heinlein"

"Fuck off! I don't work for you any more. I did my time and now 
it's my life," Anne snarled down the phone.

"It's about your daughter," the voice replied.

"What about her?  I left her with Matthew and Kat. Vowed never 
to go see her because of what it would do to their family. Look, 
Go away! Whatever it is, find someone else!" Anne snapped

"The FBI have informed us that she has been abducted in 
England," Heinlein informed her.

Anne's anger turned to worry. She had spent years of 
wondering what Elizabeth had been up to, wanting so much to 
see her first steps, hear her first words, but not daring to go near 
in case it ruined things for her. Now, deep inside her the feelings 
that only a mother can know were bubbling up. Why had she 
decided to stay away? Why did she always inflict guilt on herself 
for her past? Whatever had happened then, she now had the 
chance to put right here and now. When Elizabeth needed her 
most she would not desert her in her hour of greatest need 

"Friday are you there?"

"Yes. Ok, Consider me available. But Surely the FBI and Brits 
can deal with it?" Anne asked.

"The kidnapping yes, but not this part. When it was clear exactly 
who your daughter was, we made an agreement with her 
adoptive parents."

"Which was?" Anne asked.

"That should she show the same symptoms as you did, then 
she would be tested, and if she failed incarcerated in an 
institution for her own safety and of those around her," Heinlein 
replied in an emotionless tone.

"Sounds reasonable. If I'd had treatment earlier, a lot of lives 
would have been saved. I fail to see how that is relevant 
though," Anne commented.

Elizabeth was seen being loaded onto a plane at Stanstead 
Airport in England. A hostess saw the top of her head as she 
was being bundled out of a waiting car. It wasn't until news of 
Elizabeth's abduction was on the news did she remember it, and 
reported it to the Brits. They tracked the owner of the aircraft. It 
is registered in the name of James Adams. It took off, and 
landed at Charles De Gaule airport before we could alert the 
French authorities."

"So far it still sounds like a job for the police. James Adams?" 
Anne queried.

"The James Adams in question is the leader of the Children of 
Bexley cult," Heinlein said. Again his tone was matter of fact.

"My god," Anne gasped. The penny had dropped.

"Our analysis indicates that they want Elizabeth to become the 
new you. Once she has been indoctrinated they could release 
her, she could make up any story she wished and they would be 
off the hook. She could say that she went voluntarily and she 
forgot to tell people where she was going and we would have 
nothing to prove otherwise."

"The Bastards!" Anne swore.

"Indeed. The longer they hold her, the more chance they have 
of not only indoctrinating her, but of invoking the same MPD that 
afflicted you. We cannot allow that to happen, both for her sake 
and for those who love her. James Adam's is in LA at the 
moment. He is the only one who knows where Elizabeth is being 
taken.  The British police and our own have agreed to hand this 
over to us. Why is not your concern, just that it's your job to go 
and get her back before it's too late."

Anne shook her head in disbelief. Why would the police hand a 
simple kidnap over to the CIA? "There's something you haven't 
told me yet."

"Correct. Although we reached an agreement with Matthew and 
Jane Stephens over Elizabeth's fate we put in place our own 
safety protocols. Elizabeth is much too intelligent not to escape 
from hospital either by outright escape or by making out she is 
well once more. She is far too dangerous to fall into the hands 
of another Guild! We cannot allow that to happen again! The 
government policy on her is. Should she fail the test then she 
would be killed."

"That's inhuman! How can you justify that! You Bastards!" Anne 
swore. She knew what was coming next, but dare not believe it. 
She wanted to hear it for herself.

"We can justify it because of the fourteen million who died last 
time. We cannot and will not allow a psychopathic murderer to 
develop DNA tech once more. You never did see the big picture 
did you?"

"Fuck big picture! How do you even know she will! You're 
accusing and executing her for something she might not even 
do!" Anne was outraged. She hadn't signed up for this.

Heinlein ignored her protest "When you have recovered her, we 
want you to test her, and if necessary carry out the elimination."

"NO fucking way you bastard cunt!" Anne swore. What she was 
being asked to do was evil. 

"Would you rather someone else test her? Some psychologist 
who doesn't know exactly what she is going thru? Maybe even, 
a psychologist fresh out of training who may make the wrong 
decision? I had to pull a lot of strings to get you back on the 
team. Friday, I'm offering her the only chance she has. That 
chance is you. Off the record I think this sucks, but I do what I'm 
told and so will you! Innocent lives may be at risk. If we can 
save those lives then it has to be worth it. If you remember what 
you were like you know that she will kill given half the chance."

Anne sighed. Heinlein was right. She was the best person 
qualified to judge if Elizabeth was ok. If she refused then 
somebody else would, and that somebody else would kill, if so 
ordered. Heinlein had stepped out on a limb for both Anne and 
Elizabeth, at least giving them a fighting chance. Heinlein was 
also right in that an unstable Elizabeth would kill given the right 
trigger. "Ok Heinlein you win. But just being off the drugs 
wouldn't be enough to trigger her MPD. Something would need 
to happen to her or someone she loved in order for that to 
happen."

"That's what's worries us. We have all her immediate family 
under constant watch. Her best friend Angela Holden is missing 
as well. We think they may endanger her and use her as the 
trigger," Heinlein sounded relieved that Anne was on board 
once more.

"I dunno. That might not be enough. It depends on how close 
Elizabeth was to her. All taking the drug away would achieve is 
to allow the MPD to manifest itself. I had no qualms about 
destroying Cathline's life and she was my best friend. Anyway 
We're wasting time have the police grabbed the cult leader yet?"

"No and they are not going to. As soon as they touch him his 
lawyers will be down on us like a shot. Only his plane was used, 
and I'm sure he as a rock solid alibi. If Elizabeth is to be saved it 
falls to us to deal with it."
 

Anne swore. The Bexley cult had it all worked out, and they had 
her only child. She tried to quell the fury that was growing inside 
her and channel it into a more constructive outlet. "Do I have full 
authority to deal with it as I see fit?"

"Yes," Heinlein stated.

"Including lethal force?" Anne said calmly.

"Use of lethal force is approved," Heinlein confirmed.

"I hoped you'd say that," Anne commented. Her voice was the 
same icy tone that had terrified the gang the night before. How 
dare those bastards take her daughter? 

Quelling her anger for the moment Anne stated "It'll take me 
hours to get to LA. By that time it could be too late, and after 
that fuck knows where Elizabeth is. France was it? That's at 
least ten hours away. We're talking nineteen hours. That's more 
than enough time for them to do what they are going to do to 
her."

"Ok, in twenty minutes or so A chopper will pick you up from 
Marshall's golf course a few miles from where you are, and take 
you to an abandoned airfield a few miles away. You'd better be 
quick, as the chopper will attract attention. From there we have 
arranged a lift for you to where ever you need to go."

Anne thought. Whatever lift they had arranged had to be fast, 
very fast, if they were to stand any hope of saving Elizabeth. 
Suddenly it came to her "You have a starplane?"

"Wait and see. The chopper pilot will fill you in on the rest."

"Heinlein?" Anne said.

"What?"

"You're a bastard!"

"It's nice to know your opinion of me hasn't changed over the 
years," Heinlein replied.

-- o -- o -- o --

The helicopter carrying Anne swooped low over a small forest. 
In fact they were so low that Anne could see the individual 
branches of the trees below. Her pilot hadn't said a word and 
had only given her an address in Redondo Beach LA. Her new 
body felt strange, it always did after a full body change, but 
Anne had to safeguard the life she had made as Anne Baxter. It 
wouldn't do for Anne Baxter to be caught doing what she 
planned to do with the cult leader or his cronies. She was now a 
blue eyed redhead about five feet eight with a slim, athletic 
figure, and she was wearing a black spandex cat suit, which 
would stretch as and when she used her changeling abilities. 
She glanced down at her new legs and onto her arms. Soon 
they would become blades, armor plate bone, and poison tipped 
spines. She could become anything and everything in nature's 
arsenal. A living biological weapon. She sat back and gave a 
grim smile, "Watch out you mother fucker the hell bitch is back!" 
she whispered as if to the cult leader. 

She breathed out, trying to contain her anger. She hadn't been 
this furious since her parents had died nearly thirty years ago. 
She knew she was still on the back foot. She had just broken up 
with Mark and now this! She had only the vague glimmerings of 
a plan of her own devising, but at least it was something to work 
from.  Anne closed her eyes and tried to relax. She could feel 
the fury brewing inside her again but this time she let it grow 
inside. She remembered the way in which she had killed 
Hassan all those years ago. She remembered the warm taste of 
his blood, as she had used a secondary set of fanged jaws to rip 
a hole thru his skull as she had kissed him. As she stood over 
his body it had given her immense pleasure to see his brains 
seep out all over the floor. This was far too quick a way to deal 
with those who sought to harm her child. To those who would 
rob her daughter of the life she so deserved with Alex, and to 
those who would wipe away the joy that she had given Matthew 
and Kat over the years. For a moment, she was afraid that Lizzy 
would come back, that her fury would trigger her off again but 
thankfully 'Lizzy' was nowhere to be found in her mind. This 
moment was the acid test of her 'cure'. However part of her 
wished she could turn over control to her and come back when it 
was all over. It didn't work that way though. This was something 
she needed to do. She regretted not taking down the Children of 
Bexley cult a few months back. They had taken what she had 
done and tried to dismiss it as a hoax, revered her as some kind 
of holy figure, and now they had endangered her own flesh and 
blood! They would pay a heavy price for their actions, she would 
see to that!

She glanced across at the backpack she'd been given by the 
chopper pilot. This was her 'goody bag', as she had called them 
over the years. She was getting bored of the non-conversation 
from the chopper pilot, so she picked it up and peered inside. 
The contents hadn't changed much since she'd last been on a 
mission, infra red binoculars, window paste and her most hated 
object of all, a colt PI4543 silenced pistol. She knew this wasn't 
for her protection, she could take care of herself; it was for killing 
her own daughter.  She picked it up and held in her hand. To 
her surprise it was very light and it's balance was perfect.  It 
didn't seem to be made of metal, as it's surface was a cold matt 
black and not shiny as metal would be. She decided it was 
probably ceramic based, which accounted for it's lack of weight 
She spent a few moments familiarizing herself with it, before 
unclipping the small transmitter from the trigger mechanism and 
pinning on her catsuit. From now on the gun would only fire if 
she pulled the trigger. Ensuring the safety was on she slipped it 
into her belt and prayed she would not have to use it.

The helicopter reached an old airfield. Its concrete runway was 
broken up and uneven. Here and there old rusting aircraft lay in 
state. Anne could see no sign of her 'lift'. She looked closer and 
on the grass could see a slight shimmering effect. It was though 
something was not quite there, as if it was half in and half out of 
existence. She noticed an old Dodge UV parked to one side of 
the runway. At the sight of the chopper, a man got out of the UV 
and ran towards where the chopper was going to land

"What's that?" She asked the pilot, pointing at the shimmer.

The pilot just shrugged and after a few moments landed the 
chopper.

Anne stepped out of the chopper, her hair was being buffeted by 
the downdraft of the still rotating rotorblades. She looked around 
and saw the man running towards her. The man, in an USAF 
uniform put out his hand. Anne noticed the colonel insignia on 
his collar "Hello Colonel."

"You must be Friday. I must remind you what you are about to 
see if is beyond top secret. You will promptly forget everything 
you have and will see."

"Don't worry I intend to. Now where's my lift?"

"This way," the colonel said indicating the direction of the 
shimmering object. On the ground Anne still couldn't make out 
it's shape, only that it was about seventy feet from one end of 
the shimmer to the other.

Anne was again buffeted as the chopper took off.
   

A few seconds later they reached the object. Anne put her hand 
on it and felt metal. "What is this thing?"

"This is the Aurora 3," the colonel stated.

"Why can't I see it properly?"

"It's a combination of Electro-molecular paint, advanced avionics 
and optical form camouflage." The colonel was obviously proud 
of his toy.

"In English please," Anne stated.

"It's paint scheme can change color and shape to suit it's 
surroundings by changing the amount of current running thru it, 
and the shape of the aircraft is designed to produce optical 
illusions. In layman's terms it's color and shape confuses the 
brain so much that the brain chooses either to ignore it, or that it 
has no discernable shape at all. It's undetectable to radar and 
infrared. This is as close as you get to being invisible."

Anne was impressed. "Cool! Is it fast? I need fast!"

"So I was informed. You've heard of the star plane right? The 
passenger aircraft that flies to low orbit and then descends at 
hypersonic speeds. New York to London in an hour, New York 
to Australia in two?"

"Yep. Not in general service yet is it?" Anne said. 

"Well Aurora here will go anywhere in the world in less than an 
hour, including take off and landing," 

Anne smiled; this was just what she needed. "You know what 
they say about men and the size of their planes don't you?"

The colonel smiled, took out a small key ring and pressed a 
button. The shimmering effect cleared around the nose of the 
object and Anne saw a cockpit section emerge. There were a 
series of grab handles leading up to it.

The colonel gestured towards the cockpit "Ladies first." 

-- o -- o -- o --

The colonel strapped Anne in tightly and made her put a figure 
hugging suit and an enclosed flight helmet on.  He told her the 
suit would provide everything she needed oxygen, radio and 
protection from the high G forces she would feel. Anne listened 
intently, taking in every instruction. Unlike the Star plane this 
aircraft gave no cosseting ride. This was meant for military use.

"Ready?" The colonel's voice crackled thru the intercom

Anne gave her straps a last tug, "Sure, Check."

Anne thought there would a noise, like a rocket or something 
but all she detected was a slight surge of power and a small 
vibration thru the cockpit. She had also expected to taxi along 
the runway and take off normally, but slowly and almost silently 
she felt herself lift of the ground and go straight up. Suddenly 
the cockpit went opaque, but as she turned her head a small 
portion of her visor showed the view outside. 

The intercom crackled "We'll be using stealth engines until we 
get to 20,000 ft. I've made the cockpit opaque to ensure the 
camouflage is effective.  I'll give a countdown before we use the 
ramjet, and then finally the rocket engines. Enjoy, you'll be in LA 
in thirty minutes."

Anne felt the nose point upwards and was immediately rammed 
into the back of her seat. She could feel the G forces pushing 
every muscle and bone in her body into her seat. She felt her 
arms and legs go a little numb as the blood was pushed away 
from her extremities and into her body. She adjusted her heart 
strength and flow to compensate, and that made a noticeable 
improvement. She heard the colonel's weak, strained voice say 
"Ok we're now at fifty thousand feet. Ramjet in 5.4.3.2 1."

Another massive wave of pressure slammed Anne back into her 
seat once more. The aircraft's already ferocious rate of climb 
seemed only to increase and Anne struggled to remain 
conscious, only her ability to finely tune her body stopped her 
from blacking out. She managed to open her eyes and below 
fell the crescent shape of the earth. Thru the viewscreen the 
USA fell below her, just like a stretched out map, she could see 
storms over the east coast, sun in Florida and the Atlantic 
seemed nothing but a small blue lake. She had seen 
photographs of it but nothing had prepared her for the awesome 
majesty before her.  "Colonel?" she asked in an awed tone. She 
just had to tell someone, anyone.

For a few seconds the aircraft seemed level out An automated 
voice called "Rocket motors in 5,4,3,2,1"

Another WHAM slammed her back into her seat and didn't let up 
for what seemed an age. Of course, the G forces eased 
somewhat and a few minutes later the colonel's voice came 
over the intercom, "Hope you didn't black out for too long. It's 
normal to black out after the ramjets so don't worry. The 
autopilot takes care of things until we level out. We hit anywhere 
between 16 and 17G for around ten minutes, and if it weren't for 
these suits we'd be dead. Has yours deflated yet?"

Deflated? Anne couldn't remember it inflating. "Sure. Quite a 
view isn't it?"

"I never tire of it. We're about to start our descent so hold on"

"Already. How fast are we going?"

"We've started to slow, but we peaked at about Mach 28"

"Fast enough then. How long till LA?" Anne said. Boys and their 
toys, but this toy was going to help save her daughters life.  

The Colonel's voice crackled in Anne's ear "We should be on 
the ground in 15 minutes. We'll land just outside LA in the desert 
and a chopper will take you where you want to go. Just give 
Heinlein a call on the usual number when you're ready. It takes 
about a couple of hours to refuel and check everything, so you 
have to wait at least that long.

"Ok. What do I do next?"

"Hold on tight. We're about to become a hypersonic glider. "

As the aircraft hurtled at almost impossible speed towards LA, 
Anne knew the reason why she had never wanted to join the 
airforce. 

-- o -- o -- o --

The auto-nav in Anne's car indicated that the cult leader's house 
was just on the left. Anne had now worked out what she was 
going to do and how. It was enormously dangerous, but she 
could think of no other way. She had considered an approach 
by stealth, but the clock was ticking. A full frontal assault would 
be too dangerous in broad daylight, so a combination of the two 
was required. She drove up alongside the large house and 
checked out the tall fencing around the perimeter. There would 
be infra red and motion detectors located at every point of the 
garden, plus whatever sensors had been buried into the lawn. 
The wall was about twenty feet high with a fine wire around the 
top. Not only was this wire a sensitive alarm it was also probably 
electrified as well.

What if she vaulted over the wall, ensuring she had enough 
height to clear the sensors? If she used her superior speed she 
could be at the front door before any guards came out. Not 
having the time to do a proper reconnaissance, that was the 
best she could come up with at such short notice. She parked 
the car just off to one side of the house and got out.

She concentrated for a few seconds and felt her skull thicken a 
little. That should provide sufficient protection against any fatal 
bullets. She felt her let muscles develop and adjusted the layout 
of her knee joints to optimize her jumping ability She took a 
quick look around and took a few paces back and ran as hard 
as she could. At the perfect point she jumped with all her 
strength. Somersaulting over the wall, she landed on her feet 
and then dashed at full speed towards the house. 

Pressing herself against the wall of the house, she waited for the 
guards to come out after her, but after a few seconds none were 
forthcoming. Maybe she'd been lucky. Now came the tricky bit. 
She concentrated on her middle finger and it narrowed down 
into a thin bony point. She gently inserted it into the lock and by 
using the nerves and sense of touch still inside her finger 
adjusted the shape of the bone to fit where the key should fit. 
With a click the door sprang open, withdrawing her finger, and 
turning it back to it's normal shape Anne went inside. She was in 
a large hallway with a number of doors on each side. A flight of 
stairs led up to the first floor with obviously more rooms up 
there. 

To her surprise and relief there was nobody inside waiting for 
her. Where was everybody? She spied a woman's coat hanging 
on a nearby coat rack and she moved over to investigate. On 
the collar looked to be a freshly lost hair. She picked it up and 
examined it. Bingo! It still had the follicle attached to it. She 
placed the hair in her hand and absorbed the follicle into her 
body. Inside her body the changeling organ extracted the DNA 
from the sample and learned how to generate the shape. Anne 
felt her body change shape into that of the DNA donor. 

She checked out her new body. She was much shorter than 
before at about five six and a quick look at her arm showed that 
she was now Hispanic in origin. Knowing the cult leader's 
personality profile, she was probably some kind of maid. She 
took the coat and put it on, it would help disguise her black 
catsuit. She was surprised the house was empty but guessed 
that the cult leader would soon set a whole legion of lawyers on 
whoever decided to arrest him. That was much better than hired 
guns, which only tended to make things worse. It was better for 
her though, as she wouldn't have to deal with a small army. 
Previous experience had shown Lawyers didn't bother Heinlein 
as he had a way of making annoyances disappear.

Anne walked upstairs, trying to appear as though she worked 
there. She tried several doors along a wide and ornate hallway. 
The cult leader certainly lived well from his followers. She 
paused for a few seconds, and pulled the gun out from her belt.
She tried the last door on the corridor and a smooth silky male 
voice answered "yes?" 

Anne walked in, the gun hidden behind her back, and saw the 
man look up. The man gave a quick look at her and said "Ah, 
Juanita, would you mind taking the trash out for me?"

"Certainly," Anne said, and pointed the gun at the cult leader.

"Juanita, what's the meaning of this?" the cult leader demanded.

Anne gave the cult leader a look of pure fury. This was the man 
who had taken her daughter captive. "I'm only doing as you 
asked. I'm taking the trash out! Now walk outside, and towards a 
yellow sedan that's parked just outside. If you fuck me about 
then I will kill you!"

"Juanita, why are you doing this? If it's about money," the cult 
leader asked.

Anne gave the cult leader another look of deadly intent, "If you 
say one more word until we get to where we are going, then I 
will shoot you in the base of the spine and you will be paralyzed 
for life."

The cult leader shot the woman he thought was Juanita a fearful 
look. Where was she taking him? He did as he was told, walked 
out of his house, and stood by a yellow sedan. The woman 
holding the gun unlocked the car, and beckoned for him to get 
into the driver's seat, which he then did. The woman then sat 
beside him and pointed the gun at his groin.

"Now drive. If I see you try and attract attention I blow your dick 
off. If you make a wrong turn I blow your dick off. If you try and 
grab the gun I blow your head off. Trust me, you are not faster 
than I am, don't make me prove it," Anne hissed. 

The cult leader nodded. The woman who looked like Juanita 
gave him several directions, until he drew up along side an old 
house set away from the road. The woman took the keys from 
the car and beckoned for him to get out. He was then marched 
at gunpoint to the doorway, and went inside. He heard a 'night 
night' and then felt a sickening thud and all went dark.

He awoke an indeterminate time later and found himself bound 
hand and foot to some kind of operating table. He looked down 
and saw that he was naked and exposed. He tried his hardest to 
free himself but he was too tightly tied. "HEY!" he called out.

Anne walked in, still in her Juanita body, "Now you know what 
Elizabeth Stephens is going thru. Where have you taken her?" 
she hissed.

"Who?" the cult leader said

Anne's anger rose. Time was running out and the cult leader 
was fucking her around, "Look I know you have her. Don't fuck 
with me, I'm not in the mood!"

"If I knew I'd tell you. I swear on Elizabeth Bexley's life." The cult 
leader said.

Anne knew he could hold out indefinitely. It was time to up the 
ante. "I wouldn't swear on that if I were you," Anne felt her body 
change and within a few seconds she was in her 'Friday' body 
again.

The cult leader nearly fainted in shock. Juanita had just 
changed into a Caucasian red head in front of his eyes. That 
wasn't possible. By all the laws of biology and nature what he 
had just seen could not happen! 

Anne saw with satisfaction the shock on the cult leaders face. 
Now it was time to ram it home, "You thought I was dead. Hah! 
You have betrayed everything I ever did. Misled people into 
thinking that you had all the answers, made my friends out to be 
murderers and thieves."

"Who...who are you?" The cult leader stuttered.

Anne gave the cult leader a vicious stare that communicated all 
her hate and contempt for him in one look, "My name is Dr 
Elizabeth Anne Bexley and unless you tell me what you have 
done with my daughter, mine is the last face you will ever see."

The cult leader's mind was in shock. She couldn't be alive. This 
had to be a hallucination. He had seen her body before it had 
been buried.  That was it, he was under the influence of drugs. 
All he had to do was fight it! It was the only explanation that 
made sense. "You're not real."

"I'm as real as you are. Where is she?" Anne demanded.

"I don't know what you are talking about. Now let me go!"

"I don't think you realize just how pissed off I am. Look, Elizabeth 
Stephens was seen being loaded into your private plane. You 
have to know where she is, so tell me."

"Go fuck yourself!" the cult leader snarled.

Anne gave him a grim smile, "Now that's no way to treat your 
font of all wisdom is it?"

"Hah! If you are who you say you are we don't need you! By the 
time you find her we'll have our own Dr Bexley we can 
manipulate as we see fit. Your darling daughter will be gone by 
then, but of course you know that don't you," the cult leader's 
voice was full of disdain and derision.

Now it was Anne's turn to be surprised. The cult leader wasn't 
interested in her for who she was; it was all about being able to 
manipulate her memory and abilities to suit his own purposes.  
"I would have thought my presence here would persuade you to 
let me save her."

The cult leader tried to look at Anne's face. "Not so. You know 
the power of mythology. You used it all the time. Now that I've 
seen you alive I see that the Dr Bexley we are creating is 
much more impressive than you are. We are saving her. You 
want to keep her potential bottled up, we want to release it. 
What would you have done had you stayed in your father's 
hospital? The world would have been deprived of your wisdom. 
Of the way you forgave those that had harmed you, of the way 
you managed to turn around a hopeless situation. Think about 
what you would have been had you not found your true calling."

"Millions of people would still be alive," Anne snapped.

"You didn't cause those deaths. The Guild did. You stopped them.
Your greatest triumph! Have you seen the amount of lives that
following your example and teachings turned around? Just speak
to anyone who knows the truth, they'll tell you what a difference
you made to their lives. How could you deny future generations
the comfort we've brought to thousands? What I do is for the
benefit of everyone. Sure, Elizabeth will be confused for a
while but you can't let that get in the way of the dream!"
The cult leader sounded as though he was preaching to his
congregation.

The cult leader's tone made Anne feel sick. "Fuck the dream!
It's my daughter you're talking about and as for your
followers they'll manage. It's better they know the truth
than live a lie, as the truth will always come out, sooner
or later. Would those people still want anything to do with
you if they knew what you were planning? I thought not.
You preyed on the minds of the weak, the needy and the lonely.
You make me sick! Ok, this is your final chance. You know all
about my fearsome reputation and what I'm capable of."

"They were lies!" The cult leader snapped.

"No, they were true! As I was saying I'm running out of time so 
you tell me where she is or I get nasty," Anne snarled. 

"Idle threats," the cult leader answered back.

Anne sighed. "Ok I didn't want to do this. But you have given me 
no choice. You've studied the capabilities of my changeling 
organ correct?"

"There is no such thing! But yes I've read the fictional accounts."

Anne couldn't believe her ears. He was still denying it!," So 
you've read about how I can extract DNA from a person and then 
copy it. That was how I copied this Juanita's body, I found a live 
bit of hair on her coat and used it to turn myself into her. This 
feature works both ways. You may remember my little stunt of 
turning fish into cats on Matthew's boat? I can channel the DNA 
modification drug into a poison tipped talon so that I can 
transform any living thing into any other living thing. "

"That's bullshit! Such a change would use up too much energy 
and place too much strain on the body. Besides, it would play 
havoc with the immune and nervous systems. I must say I'm 
very disappointed in all this. Why not let me go. You'll never find 
Elizabeth in time so why bother? You should be pleased that 
your daughter will follow in your footsteps!"

"Not if I have anything to do with it she won't. Now hold still!" 
Anne walked over to the cult leader. He looked down in horror 
as a small tube grew from Anne's middle knuckle. He felt a stab 
of pain in his arm and called out "Bitch!"

Anne stood back from him so he could see her once more, "My 
changeling organ is analyzing your DNA. It'll take a few 
moments but that's all I need," the cult leader saw Anne's brow 
furrow in concentration and another small spine grew from her 
other hand. Anne turned and looked him right in the eyes, her 
look was one of deadly intent. and it unnerved the cult leader 
more than he would have thought possible. 

It then changed to a look of cold fury. She knew she 
would hate herself for what she was about to do, but she had no 
other choice. She just hoped he would play ball before she 
moved onto stage two, "If you want a Dr Bexley so bad, why don't 
you become her yourself!" She hissed and plunged the new talon into 
the cult leaders arm.

The cult leader screamed as his arm went numb. Seconds later 
a raging fire of pain ripped thru his body. It felt as though every 
nerve in his body was being held over a flame. He felt the pain 
subside in his legs but he could feel flesh rippling and his bones 
rearranging themselves. He nearly passed out as a crunch of 
bone reshaped his hips and then the fire increased upwards to 
his body. He could bear the pain no longer and passed out. 

When he awoke he felt a strange weight on his chest, and 
although he was still woozy from passing out he knew that 
something wasn't quite right. His mind cleared a little and he 
saw right away what that something was. The mysterious weight 
was two firm breasts on his chest. He screamed out loud in 
shock, and found that his new voice was a delicate contralto 
female voice.

"I thought you told me that DNA Modification wasn't possible. 
Now where IS SHE?" Anne demanded.

"What have you done to me?" the cult leader demanded. He still 
wasn't used to his new female voice.

"See for yourself," Anne said and she walked over to a small 
curtain pull on the far wall. She gave it a tug and a full sized 
mirror was unveiled on the ceiling. 

The cult leader looked upwards and screamed again in horror. 
Laying on the bed was an exact copy of Elizabeth. The woman 
had long, slender but athletic looking legs. A gently curved body 
with excellent body tone. The woman's head was topped by a 
rich mane of auburn hair and her eyes looked upwards in abject 
horror. "You bitch! You fucking bitch!" the cult leader swore.

"No not a fucking bitch I'm a 'hell bitch'. NOW WHERE IS SHE?" 
Anne demanded.

"Go screw yourself BITCH!" the cult leader swore in his new 
female voice. His eyes glanced downwards at the black triangle 
of hair between his slender legs. 

Anne gave the cult leader a vicious smile, "Yes it's gone. Just to 
prove it no illusion," Anne walked over and gave the cult leader's 
new pussy a gentle stroke. She felt no pleasure in it. It was just 
a means to an end.

The cult leader however felt a jolt of pleasure that turned to 
revulsion. It was no illusion, this woman who was most probably 
Dr Bexley was touching his cunt!. "No stop it!" he demanded.

"Why, too much pleasure for you? Where is she?"

Ignoring the feelings rushing up and down his body the cult 
leader snarled "I don't care if you leave me like this. This makes 
no difference to what happens to her. Our goal will be achieved 
and there is nothing you can do about it!" The cult leader tried to 
sound convincing, but he was worried.  What if he was stuck 
like this? He wasn't sure he could live as a woman, and how would he 
explain this to his followers?

Anne gave the cult leader a look of resignation, "Come on. You 
can tell me where she is. You don't need her, you already have 
everything you need. You have to admit you were wrong about 
the Fury. If you tell me now I'll turn you back and you can still 
continue as you were before. "

The cult leader thought for a few moments. It was a tempting 
offer, but he had prepared for years for this moment. These next 
few days were the cumulation of a life's work. He would and 
could not give them up. "No deal!"

Anne looked into the cult leaders new blue-gray eyes, "Look! 
Whatever happens, you're finished. Why destroy the life of an 
innocent girl? I don't think you are evil just grossly misguided. 
Tell me where she is and we can end this."

"No! I'm not throwing away a decade of work on the eve of its 
greatest triumph!" the cult leader snapped.

"Ok. I've proved to you that DNA modification is possible and 
that the body doesn't die when it's altered. You can feel that fact 
if you just move your body a little bit and feel those tits of yours 
move. In one act I've disproved everything you've said for years! 
Your precious cult is as good as dead and everything you 
worked for has come to nothing. You have nothing left, so let me 
have her location and you can go free."

The cult leader knew that Anne was right but Dr Bexley, his Dr 
Bexley would be able to turn it all around. She was his last 
hope. "No I won't! Elizabeth will be able to build a new world for 
her children from the ashes of this one!" His womanly voice still 
sounded strange to his ears, but it didn't matter. In a few hours 
Elizabeth would be his, and in any case she would be able to 
switch him back in a while.

Anne was exasperated and this fuelled her anger. She tried to 
calm herself down. Getting angry would lead to mistakes and 
she couldn't afford that. The cult leader wasn't going to budge 
from his position. With great reluctance she decided she had to 
move to phase two. 

The cult leader saw Anne move towards, him and take hold of 
his slender arm. He saw her other hand had another talon 
coming out from her knuckle. He screamed a high pitched 
scream as he felt the talon plunge into his arm. Once again his 
body was on fire and he passed out under the pain.

When he awoke he was dreading who or what he would 
become but as he looked up into the mirror he saw his old face 
looking back at him. Had his tormentor given up? He looked 
down at his arm and saw tubes running out from the wrist and 
on his other arm and on his chest were sensors stuck down with 
surgical tape.

Anne noticed that he was awake and said, "No I haven't given 
up, but I need you to be in this form for what I'm about to do. 
Incidentally I've used the DNA sample I took earlier to turn you 
back. Now I beg you, please tell me where Elizabeth is?"

The cult leader shot Anne a look of defiance, "Why are you 
begging me? What are these machines for? You know what my 
answer is going to be, so why bother asking again. Whatever 
happens Elizabeth will serve the Children of Bexley."

Anne gave a look of great sadness at the cult leader. She had 
been left with no choice. Part of her hated herself for what she 
wasa about to do and the other just wanted to nail the bastard for 
what he'd done to Elizabeth, "Ok this is what's going to 
happen. Those machines are connected to you to keep you alive and 
conscious and to ensure that you have enough blood to last 
throughout the procedure."

"Procedure?" The cult leader was horrified. What was going to 
happen to him?

"As you know I am a skilled surgeon. I'm going to take you apart 
organ by organ until you tell me where Elizabeth is." Anne 
spoke in a voice as though death himself was speaking. 

"No you can't. There are laws!" The cult leader gasped.

"Laws that you conveniently forgot when you took my daughter!" 
Anne snarled.

"No, please. I'll do anything," The cult leader whimpered.

"Then tell me where she is?" Anne snapped.

"Not that. It's my life's work!" the cult leader had regained some 
of his composure.

Anne moved to one side, picked up a gleaming stainless steel 
scalpel, and placed it on a tray at the foot of the table. She 
ensured that the cult leader saw her pick up a number of forceps 
and scissors and she put them into the tray as well. She then 
picked up a small flashlight sized object. "You know what this 
is? It's a laser cauterizer. When I remove an organ it'll stop the 
bleeding by sealing off the wound."

The cult leader struggled to break free. He thought for a second 
he could manage to free a hand but then found that it was just a 
false hope. "If you kill me then you'll never find her!" he shouted 
defiantly.

"Then you'd better hope I do. Now the first thing we do is make 
an incision down the length of the chest," Anne's voice had 
adopted a lecture tone of voice.

The cult leader screamed in pain as he felt the thin point of the 
scalpel enter his chest, and the burning pain continued until he 
could bear it no more. No matter how hard he tried he couldn't 
relieve the pain by passing out. More pain wracked his body as 
through eyes slitted in pain he felt his torturer slowly peel back his 
flesh until his layer of muscles were exposed. 

Anne pinned back the cult leaders skin so it formed a thin, 
translucent sheet going from outside of the cult leaders chest. 
She ignored the amount of blood that was seeping out of the 
skin. That was a small amount compared to what would come. 

Anne said, "Whenever you are ready to tell me just say stop!" 
She then paused for a few seconds and said, "Not ready to tell 
me yet? Ok, let's make a nice cut through all that muscle, shall 
we? Actually, the cut will be from mostly your rectus abdominus 
muscle down to your conjoined tendon," 

The cult leader felt another wave of indescribable pain as in the 
mirror he saw Anne run the scalpel down the length of the 
muscle covering him. He felt himself retch and he turned his 
head sideways so that his vomit wouldn't choke him.  

Anne watched the cult leader throw up all over the floor. 
"Thanks, that will make your stomach easier to remove," she 
hissed. 

The pain was continuous now. There was no let up as wave 
after wave of it crashed thru the cult leader's body. The pain had 
started to confuse his mind, but one thing he knew -- he had to 
hold on. Elizabeth was his last chance. 

"Where is she?" Anne asked.

"Not.. saying.," the cult leader said. Lashings of pain interrupted 
each word.

"Have you ever seen a spleen? I have," Anne asked the cult 
leader.

Anne smiled and picked up her scalpel again. The cult leader 
felt Anne's hand inside him and he closed his eyes, waiting for 
the pain that was sure to come.

"I'm about to cut thru the spleen's fibrous coat and splenic 
artery. Anything you want to tell me?" Anne said. She had 
switched off all her emotion. One thing fixed in her mind, she 
had to get to Elizabeth as soon as possible!

"Go... To Hell, " the cult leader said hesitantly. He felt a small cut 
inside him and another level of pain was added to that which he 
already felt. The pain wasn't sharp but a growing wave of dull 
agony. He opened his eyes and wished he hadn't as he saw his 
chest open and awash with blood. His skin and muscle had 
been pulled apart and pinned open by clamps.

Still in her lecture tone of voice Anne said, "Did you know the 
average length of a human small intestine is about 23 feet? 
Let's find out, shall we. Unless of course you want to stop."

Mustering all his strength the cult leader managed to say, "No," 
there was more at stake than his life.

The cult leader cried out in pain as he felt Anne make another 
incision inside him. Pain turned to revulsion as he saw her lift 
out a long yellow, fleshy tube and hold it in front if his face. He 
nearly threw up again but somehow he couldn't. He saw Anne 
reach towards his small intestine with some surgical scissors 
and all of sudden another hammer blow of pain struck him. This 
wasn't the sharp, immediate, screaming kind that he had felt, 
before but one of utterly intensive, overwhelming, and 
continuous agony.

"That's one foot," Anne said, discarding a small piece of 
intestine on the floor.

The cult leader screamed in pain as another wave of this dull 
but intensive pain crashed thru his body. He tried to bend 
double, to somehow relieve the almost unbearable agony, but he 
was held firm hand and foot. His, body, unable to relieve the 
pain, just added more and more intensity to it in ever increasing 
magnitudes. 

"Two feet," Anne said gently.

Just as that scream died in his throat another way joined it as 
another wave of intense agony crashed thru his body. 

"Three feet, Only twenty more to go," Anne said gently.

Another loud scream pierced the room as he felt the 
agony of another cut, and another, and another, and so the pain 
and screams went on until he could bear no more. He thought of 
the harm this evil woman would inflict on his precious child if he 
gave in. It gave him the strength to hold out a little longer.

"Hmmm, your small intestine was only 22 feet in length. Never 
mind, size doesn't matter, or so they say," Anne said with a 
vicious smile. She continued on in the same tone, "Now I didn't 
really think you'd have the stomach to hold out for so long. 
Maybe that's what's next. Come on, where is she? I'll stop if you 
tell me."

"No," the cult leader gasped. Part of him wanted to end the 
torment his body was going thru. Every nerve in his body was 
screaming in pain, like nothing he had ever experienced before. 
He couldn't help but look at his gaping chest in the ceiling 
mirror, and he tried once more to vomit, but there was no release 
from the pain and horror. He felt Anne's hand go inside him 
once more, and the now familiar stab of pain crashed over 
him again, exceeding that of the agony he now felt.

Anne pulled out a large reddish blue object and showed it to the 
cult leader, her hands dripping with blood, bile and gore. "Now 
I'm going to cut thru the gastric and fundric zones into the 
gastric folds."

The cult leader looked on in horror as Anne cut a slit in his 
stomach. The look turned into a blood curdling scream as she 
poured his stomach contents into his chest cavity. More pain, 
agony, and horror than he could imagine wracked his body as 
the acid and bile ate into his remaining organs. It felt as though 
a million hot needles were being stabbed into every part of his 
chest. Another massive scream erupted from his mouth as he 
felt the acid eat deeper into him. He stole a look upwards into 
the mirror and saw that the blood had been cleared away a little,  
and now in it's place was a greenish liquid, mixed in with the 
deep red of arterial blood. Nothing was worth this much pain. It 
had to stop. It was too late now anyway. His Dr Bexley would 
come to into being whatever he said. He had won! "STOP!" he 
screamed as loud as he could but it came out no more than a 
whisper.

"Where is she?" Anne demanded.

"Gilcar Farm, near Park Mill, Yorkshire, England. But it's too 
late," the cult leader gasped. 

"See. You needn't have gone thru all that pain need you?" Anne 
said soothingly. She turned away from the cult leader and went 
to walk away. As she did so she concentrated hard and felt a 
tube form from her wrist. She had to be careful as a single bony 
dart grew inside it. What it contained was not to be messed with. 

"Please, cure me!" The cult leader gasped in pain. The pain had 
still not subsided, and if anything was growing in intensity.

"My pleasure," Anne said and fired her dart at the cult leader. It 
struck him clean in the neck and seconds later he gave a loud 
gargling scream.

Anne looked on, as the cult leader's body seemed to go limp. 
Bulges of fluid formed under his skin, which then ruptured 
spewing a pink, semi solid fluid all over the floor. With one last 
scream the cult leader seemed to deflate as more and more of 
his body dissolved into more and more of the pink fluid. 
Seconds later the pools of blood that were on the floor were 
mixed in with the remains of the cult leader. 

Anne turned around and fled out of the house. Not only because 
it was a race against time, but also because the full reality of 
what she had just done had just dawned on her! She had acted 
without mercy and without remorse. As she climbed into her car 
and sped towards where the chopper had landed she suddenly 
felt as though she had become a monster once more. She tried 
to justify what she had done by telling herself that it had been 
required, and that taking down the bad guys in order to save her 
daughter was an acceptable thing to do. 

Maybe if she had used minimal force she could have justified it, 
but this was by no means minimal. Somehow she had allowed 
herself to be consumed by anger and worry for Elizabeth's 
safety, such that her actions had become second nature. One 
thing was for certain. Mark would never have her back now, and 
the way she felt now she wouldn't blame him. She truly was 
death incarnate. What in hell was she thinking when she'd had 
planned the whole thing out in her mind? One thing was for 
certain, Heinlein would be mad at her! And yet, as he had 
authorized the use of lethal force, what did he expect! That 
thought caused her more concern. A part of her had enjoyed 
performing the act of death by vivisection on the cult leader.  He 
had systematically taken apart her whole life and built it into a 
lie. It was fitting that she did the same back to him. 

Anne shook her head, to clear it. What in hell was she thinking? 
Even in her most vicious times of insanity she had never acted 
in this way, and yet, she was now supposed to be cured! She 
hadn't changed one little bit. She had used excessive force on 
Hassan all those years ago, several times when working for 
Heinlein and now, when she was living her new life as Anne 
Baxter, she had ripped apart those gang members who had 
threatened her and Mark. Now this had happened and this was 
the worst of all. She had used her medical skill to kill someone 
bit by bit! It didn't matter that he was one of the bad guys; she 
had no right to do that to him. The thought only made Anne feel 
worse, but it was too late, the deed had been done and now only 
remorse remained. 

She thought of dear, sweet Mark back at college. Perhaps she 
had been right to leave him, in spite of her feelings for him. 
Maybe she was just too evil to love. This made her feel even 
more depressed. Anne spoke to her car hi-fi, "Car track 19 
personal collection," the in-car hi-fi beeped and began to play.

        "In my dreams I'm dying all the time 
        As I wake its kaleidoscopic mind
        I never meant to hurt you I never meant to lie
        So this is goodbye.
        This is goodbye

        Tell the truth you never wanted me
        In my dreams I'm jealous all the time 
        As I wake I'm going out of my mind
        Going out of my mind."

Anne didn't feel in the mood for music. "Car music off!" So she 
tried to put the thoughts out of her mind, instead focusing on the 
mission ahead. Within minutes she would be at the helipad and 
within an hour and half in English airspace. Now all she had to 
do was hope and pray that Elizabeth could hold out.

-- o -- o -- o --

Flight BA7877 carrying an extremely worried Kat was just over 
India as Anne's 'lift' was hurtling towards England. She was 
sitting back in her seat trying not to worry but failing miserably. 
She hadn't been this worried since she had been kidnapped by 
the guild all those years ago.  Now once again she would have 
to dig deep within herself for the trials that were sure to come. 
She had tried to get hold of John but he was out with his friends 
hiking in the Australian outback and his PDA wasn't turned on.  
What did the people who had taken Elizabeth want from her? Or 
even from them? If it was money, that wasn't an issue. What if it 
was something else?

Her blood froze as a thought crossed her mind. They didn't want 
money. Matthew had told her that. What if they wanted 
Elizabeth? What if whoever took her knew that she really was Dr 
Bexley's daughter, not their own? What if they thought that they 
could make Elizabeth into a kind of Dr Bexley re-incarnation? 
Her PDA bleeping interrupted her train of thought. She fished it 
out of her jacket pocket, untangled the earpiece, and put it in her 
ear.

"Yes?" She answered.

"Hi it's me," Matthew answered.

"Any news?" Kat blurted. 

"Not really. I just called to see how you were."

"Bearing up. I'm going to get there too late aren't I? Why in hell 
do we live so far away from everything? I've not even crossed 
India yet. I'm too old for this kinda crap now." Kat eyes started to 
fill with tears.

"I know what you mean. I've called the FBI and the Brit police 
and they tell me it's all under control and not to worry. Alex is 
resting now. He's been beside himself with worry. He's on the 
front line and he's only a kid!" Matthew said softly

"Not much younger than you were when SHE did all that stuff to 
us. He'll cope. We've got each other no matter what happens. 
As long as we stick together like we always have we'll be ok." 
Kat tried her best to sound convincing, but why did she doubt it 
herself?

"I guess so. At least we knew who our enemy was," Matthew 
commented.

Trying to sound a lot braver than she felt Kat replied "The 
enemy is always the same no matter the situation. Fear is our 
enemy. It robs of our power to think and to reason. It destroys 
the bonds of trust between us, saps us of our energy with which 
we fight. Matthew, we need each other, Cathline, Alex and John. 
All of us together must face fear and overcome it. If Elizabeth is 
to live then that is the only thing we can and must do."

"Thanks Kat. I have to get off the line now, just in case. I love 
you more than I can ever express or say or do."

"I know. I always have known, and I feel the same way about 
you. Love you," Kat replied tearfully.

"Bye," Matthew replied softly. This wasn't over yet, not by a long 
way.

-- o -- o -- o --

Elizabeth struggled to get her eyes open. Her head ached like 
hell; she was feeling so woozy and so confused. As her mind 
cleared a little she realized she was sitting down in a chair. She 
tried to get up, but found herself unable to move. She managed 
to get her eyes open but could make nothing out in the darkness 
of the room. Suddenly a bright white spotlight flooded the area 
where she was sitting, momentarily blinding her. "Hey," she 
called out.

The rest of the room remained dark, and even after adjusting to 
the light her eyes couldn't make out any detail in the shadows. 
She glanced down at her hands and saw they had been 
securely strapped down, as were her legs. She was clearly 
going nowhere. "Where am I? What you going to do with me?" 
she called out. Her voice showing her fear.

Again there was no reply from whoever was holding her but in 
the back of her mind she heard Deianeria say, "Now it's time."

"Time for what?" Elizabeth whispered.

"My Time," was Deianeria's cryptic reply.

A heavily disguised voice came from a speaker somewhere in 
the far corner of the room. "Welcome, precious daughter. Now is 
the time for you to take your rightful place amongst us. Your old 
life is over, your new one is about to begin."

"Who are you? What do want? Why am I here?" Elizabeth 
demanded. They had called her 'precious daughter'. The phrase 
sounded familiar. Suddenly it came to her. The Children of 
Bexley cult were holding her captive. What did they mean her 
old life was over? There was no way she was going to join them!

The voice spoke once more "We have prepared for years for 
this day. You have prepared for it your whole life!"

"What are you talking about?" Elizabeth demanded. She could 
see no obvious way out. Deianeria had promised to help, to 
protect her maybe she could help?

"Deianeria?" She whispered to herself.

"This is my time, yours has almost gone," Deianeria whispered 
back, echoing what the voice had just told Elizabeth. Elizabeth 
then felt a dark murky oppression in her mind. Like a headache 
coming on, only hundreds of times worse. 

A feeling of dread and fear ran thru Elizabeth. What was 
Deianeria playing at? She had trusted her, listened to her advice 
and handed over her protection to her. Now it seemed as 
though Deianeria was trying to take over! Her ears picked up the 
sound of someone walking into the room, but she couldn't make 
out any more details than that.

A thought struck her, Angela! What had they done to Angela?
"Angela is she.." Elizabeth called.

There was no reply and suddenly the lights dimmed for a few 
seconds and then blazed back on again. For a few more 
seconds Elizabeth was disorientated, but she could make out 
the shape of the person who had entered the room. It was 
female and about five feet nine with black hair. As the details 
became clear she saw the woman's face. It was Angela!

"Angela, you're OK! Quick, let's get out of here!" Elizabeth 
screamed.

"Hello Elizabeth," Angela said coldly.

The realization hit Elizabeth like a sledgehammer. Angela 
wasn't here to help her at all! She was involved! She felt 
physically sick at Angela's betrayal. She tried to speak, but all 
she could hear in her mind was Deianeria's manic laughter. Her 
mind whirled with confusing thoughts. Firstly sadness then 
anger and more anger at being betrayed by her best friend.
"Angela why?" she sobbed.

"It's what I was trained to do. We have plenty of time so I will fill 
you in. The more I tell you the more you will free yourself and 
your potential."

"You lied to me!" Elizabeth cried out, enraged.

Angela gave Elizabeth one of her sweet smiles "I've done more 
than that. In a few hours, you will be who you were always 
meant to be. "

"Stop saying that! I'm meant to be me. I'm meant to marry Alex, 
I'm meant to be a doctor," Elizabeth anger rose with every 
passing moment.

"One of out three isn't bad. You are meant to be a doctor, but 
not the doctor you thought you were going to be."

"Bitch! I'll resist you. I won't do it!" Elizabeth now added hurt and 
pain to her anger.

"Yes you will. Simply because you have no choice."

"I always have a choice."

"No you don't! Let me explain. My real name Is Angela Adams, 
but I'm afraid I'm not adopted. My father is James Adams and 
my mother was just someone he liked the look of."

Adams! That was the same surname of the cult leader of the 
Children of Bexley, "No you can't be!" Angela was the daughter 
of the Cult leader James Adams. She had revealed her 
innermost secret in exchange for a lie. Another betrayal of trust! 

"I was trained from the age to ten to be able to think like you do, 
to know what you most wanted in a friend, and know every 
thought, word, and deed you were going to do. I know you better 
than I do myself. I was trained to be the perfect friend to 
Elizabeth Cathline Stephens. It's what I was born to do! When I 
read where you were going, my father ensured that I would be 
your room mate. I was to be the tool that would unlock your 
potential. I did like you, Elizabeth, which made it easier for me to 
be your best friend. I couldn't have been so effective otherwise! 
But soon you will be gone, and a new you will be born. We can 
then start off our friendship again, brand new, with no hard 
feelings and no secrets from each other!"

Elizabeth was about to say something when Deianeria's giggling 
swamped her thoughts and nearly overwhelmed her mind. 

"Stop it!" Elizabeth shouted to herself.

"I see it's working. The true you is breaking free. Soon you'll
be the person to lead us into personal nirvana, you'll know the
answers to all our problems and be wise enough to help us deal
with them. Just think of all the people's who's lives you'll
change for the better."

Elizabeth tried to ignore the oppression in her mind but it
Was rapidly becoming worse.

Angela continued to speak, "Just think, after you are free,
we can be together just like we used to be, as best friends," 
Angela smiled as she had done so many times when she and
Elizabeth had been roommates.

"Fuck off!" Elizabeth snarled.

"Your whole time with me was carefully staged and managed. 
Remember the trip to Ely to play a joke on my dad? That was 
my idea wasn't it?"

Elizabeth nodded, unable to think straight.

"That was designed to do two things, firstly to show you off to 
our followers and secondly to start to unbalance you. To drive 
doubt and fear into your mind and into your heart about who you 
really were. We needed to see if you really had the potential to 
be who we knew you were all along. Your outburst and subsequent 
elation at being praised told us everything we needed to know. I 
had to move slowly and carefully. Move too fast and you would 
suspect. We had to move softly, and a bit at a time or else all 
would be lost. All those picnics, coffees, and late night chats 
were designed to gain your trust. Let you open up to me, 
'Dearest Angela my best friend in the whole wide world'." Angela 
gave another mocking smile.

Elizabeth was still unable to think. Deianeria was now silent and 
inside her the feelings of betrayal fed upon those of hurt and 
pain and those of hurt and pain fed upon betrayal. The dark 
oppression in her mind was gaining in strength and ferocity. 
Elizabeth found that by concentrating she could keep it at bay.

"Ever wonder why your medicine has been having such little 
effect recently? By now how you are is your natural state of 
mind, so I doubt you gave it much thought. From the first day we 
spent together I have been replacing your Olanzapine with a 
drug of our own making. You thought you had stopped taking 
Olanzapine for only a few days. In fact you have not had any for 
over six months. My little helpful trips to fetch your medicine 
were just an excuse for me to bring in new supplies of our own 
drug. Olanzapine suppresses who you really are. We could not 
allow that to happen again."

"What was the drug?" Elizabeth managed to say, her voice full 
of fear, the fear that had for the moment replaced the fury. What had 
been done to her?

Angela gave a cruel smile. "Dose by dose it built up your 
resistance to Olanzapine or any other treatment you might take 
to prevent the real you from taking hold. In order to suppress the 
new you, you would need to take so much Olanzapine it would 
kill you. You can never be rid of the new you. She will always be 
there in your mind. Not that the drug will be required after today 
anyway."

"What's going to happen to me?" Elizabeth stammered. 

"That would be telling. Remember Nick? He was another trigger 
I set in place to put you off balance. To put pressure on the 
fragile old you to make it easier for the new you to come out."

"Nick was a set up?" Elizabeth sobbed. She tried to close her 
eyes and remember the fun times they had had together, 
anything to get rid of the constant stream of betrayal and hurt. 

"Ever wonder who the 'other woman was?' it was me! You thought
yourself so aloof and superior, but it was me who stole him away
from you He was a set up. And you're supposed to be the clever one. 
Everything was a set up."

"Did I kill him?" Elizabeth asked, fearful of the answer.

"He was already dead. As soon as he went out with you his fate 
was sealed. I did the deed myself. I must say, for a man of his 
size he was an easy kill," Angela voice was emotionless as 
though she had just described stepping on an ant.

Elizabeth gave a loud cry. She hadn't had him killed, but she was 
responsible for his death. It hadn't just been a mugging, it was 
another step in the plan to get at her. She felt the dark stifling 
pain of Deianeria move closer into her mind, threatening to snuff 
her out at the slightest chance.

"When dad came to you with the receipt and told you to look at 
the facts, that was to make you look into yourself. By now we 
had applied enough pressure for your new personality, the real 
you to start to show thru. You responded brilliantly, even better 
than we imagined you would. Your little quest served to divert 
you away from our real intentions, blindside you so that when 
we took you it would all be a surprise. It also freed your mind to 
allow the real you to surface. We had a cleaner plant the fake 
journals at your parent's house. Did you know that I wrote them? 
It took me years to perfect Dr Bexley's handwriting, by the way. 
By the time you came back from vacation your mind was a 
battle ground between Elizabeth and the person you call 
Deianeria."

Elizabeth gasped. How did she know?

"I heard you talking to her during the night. I lived and breathed 
every moment with you, remember. It was when I heard you 
refer to Deianeria that I knew our plans were working. The 
months of constant pressure and diversions were beginning to 
work, that combined with the lack of Olanzapine. You were 
starting to become who we wanted you to become. The real you 
is Deianeria. I'm sure she's in there right now forcing her way 
into your conscious mind," Angela 

Elizabeth stayed silent. Deianeria was getting harder and harder 
to suppress. The more Angela revealed her betrayal, the more 
she inflicted hurt and pain on Elizabeth, the more difficult 
Deianeria was to stop from swamping her mind and taking over. 
She then realized that was that they were planning to do. In her 
confused and distraught state it had taken her longer to reach 
that conclusion than it should have done! She needed 
something good and solid to focus on. If she could manage that 
then she would be able to resist. She remembered back to her 
first date with Alex and their first kiss. The shivers of delight it 
gave her and the thought of her marriage to him raised her 
spirits and helped keep Deianeria at bay.

"If you are wondering why you felt so woozy it's because the 
effects of the CAT scan are just wearing off," Angela noted with 
medical precision.

"CAT Scan?" Elizabeth said. She was still trying to focus on 
Alex.

Angela checked her watch "Yes, it should have gone out by 
now. You see while you were unconscious we flew you to France,
took some blood tests and a CAT scan and while you were being
moved back here we compared them to the treasured Dr Bexley. 
They confirmed what we already knew, that you are her 
daughter, and not Matthew and Jane Stephen's. We've sent that 
and all our other evidence to several international news 
organizations. I suspect in a day or so the whole world will know 
the truth about you. It'll take them a while to verify the story,
but rest assured the truth will get out. I wonder how would your 
beloved Alex react to you then?"

"NOOOOO!" Elizabeth screamed. From now on she would be 
an outcast. Looked upon with fear and distrust wherever she 
went.  All her nightmares about being hounded in the press, 
watched by the police every time she went places were coming 
true. She didn't even now have the luxury of being able to give 
people the comfort of her being on Olanzapine, as she was now 
unable to use any form of treatment. Angela was right. What 
would Alex say? She hoped that he would stay with her, but she 
couldn't guarantee that. Her only chance was to stay in exile on 
her parent's island, but what kind of life would that be? She 
would be unable to go out, have a career. She would effectively 
be in prison. She could feel Deianeria start to push thru the 
barriers she had erected. How much more could she stand 
before she gave in, before Elizabeth Stephens was gone, 
consumed by the person called only Deianeria.

"I see you see the reality of your situation. You can either stay 
with us and we'll provide everything you need. Friends, a career, 
people who love you, or you can be hunted down everywhere 
you go. Sure in time the press coverage will fade but every job 
you go for, every friend you make will know of what you are 
capable of and who you are. Your other choice is to go it alone, 
trying to make a life for yourself as best you can. I know how 
hard you find it to trust people, think how much more difficult 
that will be now."

Elizabeth pushed down her anger and sadness. "There's always 
Alex, Mom and Dad, John and Cathline. I don't need anyone 
else!"

"Ahh yes family. The last refuge of the desperate," Angela's 
voice was deathly quiet.

"What are you going to do to them?" Elizabeth asked fearfully. 
She could no longer think in any detail any more. Although 
Deianeria was silent, she could feel her oppression in her mind. 
It was slowly and inexorably strangling the life out of her. She 
couldn't take much more of this. Was oblivion better than the 
living hell she had been exposed to now? It was certainly 
tempting, all she needed to do was let go, Deianeria would take 
over and she would be gone. Her love for Alex and her family 
was her last stronghold. Nothing Angela could say or reveal 
could knock down its walls. "If that's all you've got Angela, 
you've failed. I'm still here!" She said, mustering all her defiance.

"Oh no I've saved the best till last. I'm going to tell you this now 
but the rest of the world won't know until your wedding day, if it's 
still on that is. The beloved Dr Bexley only revealed her true self 
when her wedding was ruined. We're going to do the same for 
you."

"How? Alex won't leave me. You can't deny his love for me," 
Elizabeth said triumphantly.

"True but the law can," Angela replied. Her voice revealing that 
she was going to relish the next part. 

"The law. The law can't touch us! Neither of us are married!" 
Elizabeth saw the look of supreme confidence on Angela's face 
and her concern grew. What did Angela know? What could 
Angela possibly know?

"I'm afraid the law expressly forbids brother and sister to marry. 
Whether Alex loves you or not, it doesn't matter a single bit. You 
are his sister." Angela gave a broad smile.

"No you're lying!" Elizabeth sobbed. She had to be lying! Alex 
wasn't her brother, how could he be? She felt the tendrils of 
Deianeria's presence start to infiltrate into her final stronghold. 
She dug down within herself, drawing on the last reserves of 
strength. Her final hope that Angela was lying.

"No I'm not. You see we worked it out years ago. We know 
every word Cathline wrote in her books. You will too when you 
join us. The key section came after Cathline was kidnapped by 
the Guild again and handed over into Osman's care. He had 
burned her eye out again and left her chained hand and foot to 
the wall. Let me quote Cathline's words to you 

        'I was exhausted and tired. Osman had just burned my 
        eye out again. Supposedly repeating the punishment he 
        had inflicted on me all those years ago. Inside I ached 
        and I could still feel the sickening feeling of violation 
        from when one of Osman's bodyguards had decided he 
        would be the first man to fuck Rachel Martin. I had tried 
        to resist but he was too strong for me. 

        I can't remember too much about my time chained to that 
        dungeon wall. It brought back too many horrific memories 
        of my time in Osman's dungeon where I had been raped 
        every day for four months. Tina would hurl abuse at every 
        man who came in to take me, she tried to attract his 
        attention away from me but it didn't work. They always 
        came for me. My eye still gave me incredible pain and 
        there seemed to be no end to the cycle of rape and 
        violation. I had to hold out, no matter what!

        That was until Salah came in. I took one look at him and 
        sighed in resignation. Tina was hurling abuse at him but 
        he just ignored her and started to screw me. He wasn't 
        like the others. He seemed kinder, gentler, as if he really 
        cared for me. He touched me in places that I had only 
        told a few people Kat, John, and Dr Bexley, I liked to be 
        touched. 

        My spirits rose when he told me he was going to get us 
        out. I knew he was going to take me whatever I did so I 
        relaxed and let myself enjoy it. After he had come inside 
        me he gave me a single fingered salute and left.'

Angela set the book down, and smiled coldly at Enizabeth.  
"Who was Salah at that time? It was your Mom, wasn't it? She 
was a fully functional man at the time. We know from Guild 
archives that Kat was the only person to screw Cathline during 
her time in that dungeon. Cathline never was never serially 
raped in that dungeon! If you work back the dates then nine 
months from the date this occurred is Alex's birthday. That's why 
he's got an Arabic look about him. He's what, four months older 
than you are? Strange timing don't you think?  Alex is your 
brother and we are going to reveal that to the world on your 
wedding day."

"Please you can't. No, anything but that! I'll do whatever you want, 
anything but that," Elizabeth sobbed. Her mind was so 
confused. She didn't know what was real anymore! 

"Your parents and Cathline must have known. Cathline did! 
That's why she lied in her book! To try and fool people, but it 
didn't fool us. Your Mom as Salah protected Cathline from 
being raped but Cathline covered it up! They lied to you 
Elizabeth, and they weren't going to tell you. You would have 
been illegally married to your brother and they weren't going to 
tell you.  What does that say about them, Elizabeth? You can 
tell how people really feel about you by the way they treat you. I 
bet they never kept things from John did they? How can they 
love you if they can do that you? You're not even their real 
daughter are you?"

Elizabeth's eyes glazed over and she gave a blood curdling 
scream and then slumped almost lifeless in her chair. Deianeria 
had finally breached her last line of defense.

-- o -- o -- o --

Anne decided to walk the kilometer from Park Mill to Gilcar 
Farm. It would be much safer and allowed her time to gather her 
thoughts and refine her plan.  She positioned herself on the 
road just above the old ramshackle farmhouse and put her infra-
red binoculars to her eyes. It took a few seconds for the 
readings to show but she saw a single figure, apparently sitting 
down, outlined in yellow and orange in the middle of a room and 
another figure standing near it. The figure sitting down must be 
Elizabeth. She scanned the surrounding area for more figures 
but saw no one. As she suspected the cult had relied on 
secrecy and stealth rather than brute force. Having hundreds of 
armed guards running around would attract attention where 
single figure in a remote stone clad farmhouse wouldn't even 
raise an eyebrow.

She flicked a switch on the side of the Binoculars and the view 
turned from orange and yellow blobs to an eerie green glow.  
She zoomed into the surrounding countryside and the scanner 
built into the viewfinder showed that there were no transmitters 
or electronic devices around. The farmhouse was protected only 
by the stealth and secrecy afforded it by a fanatical group of 
people, which as Anne had to admit was often the most difficult 
to crack open.  Another potential complication was the fact that 
the Children of Bexley's organization and execution of the 
kidnap was amateurish at best and at worst very dangerous. 
There had been no cover for the cult leader, and now no cover 
for where Elizabeth was being held. It was clear that the cult 
wanted to keep a low profile and that was the reason for the 
lack of backup. In a way, what was more worrying was the fact 
that it was easier to deal with 'professional' hostage takers than 
amateur ones. Anne was under no illusions that if the Guild, 
back in their heyday, had taken Elizabeth captive things would 
be a lot different.

Switching back to infra red, the figure standing up moved out of 
the room and into a side room. Whatever had been going on 
had either paused or had been completed. Anne prayed it was 
the former. The figure sitting down was still showing a healthy 
orange glow, so Elizabeth was at least still alive. Anne stood up 
from her crouch and as she did so the pistol she was carrying 
dug into her leg. It was a painful reminder of the task she was 
ordered to perform should it be required. She had no choice but 
to carry it out. If she failed then someone else wouldn't. There 
had to be another way, didn't there? 

As quietly as she could, using low cut stone walls, farm 
machinery, and bushes for cover she crept towards the house. 
She crept to one side of a ground floor window and pulled out a 
metal tube. Unscrewing the lid she ran a small line of white 
paste along her side of the window. Ducking down she did the 
same for the base of the window, ensuring the paste met the 
other line she had just squeezed out. Within a few moments the 
entire glass of the window had a white rectangular paste line 
around it. From her backpack Anne pulled out a small metal 
cube and bracing herself under the window pressed the cube 
into the paste.

A few seconds later the paste started to fizz and glow red hot. 
Anne braced the window as the rapidly heating paste melted the 
glass around the window. A few moments later the glass fell into 
her hands.  She held the window for a few seconds, allowing the 
glass to cool before she placed it on the ground beside her.  
The police would think it was how the kidnapper had gained 
entry.

Checking with her infra-red binoculars that the kidnapper was 
still in another room, she climbed inside. Stashing her binoculars 
in her backpack, she listened for any signs that she had been 
heard. Satisfied that she was undetected; she concentrated on 
her left arm. Within a few seconds, a small hollow tube about six 
inches long grew from her elbow and out of her knuckles. Inside 
the tube she could feel the darts containing a powerful neuro-
toxin start to form. It wouldn't kill, but it would paralyze for 
several hours and leave no traces in the bloodstream. 

After creeping into the hallway, Anne paused for a few seconds, 
checking again that there was no sign of detection. She heard a 
faint sound coming from a room to the left. Quietly and quickly 
she edged herself along the side wall. The sound grew louder. 
Whoever it was coming out of the room! Anne readied herself 
for action, and waited, holding her breath while the door slowly 
opened and a figure stepped outside.  

Anne watched the tall brunette walk out of the room, tray in 
hand and with her dart arm took aim. She stepped out of the 
shadows and said, "Hello there."

Angela jumped in shock, dropping the tray in the process, and 
stared at the tall red head waiting in the shadows. She heard a 
slight hiss, then a jab of pain and she looked down at her 
shoulder. A large thorn was sticking out of it and within a few 
seconds her head span and it all went black.

Anne stooped down over Angela's paralyzed form and slung her 
over her shoulder. She didn't want her waking up and getting 
help. For a moment she considered putting a bullet in her head, 
but then decided otherwise. She would determine Angela's fate 
once she had checked out Elizabeth.

Trying to visualize the layout of the house in her mind she took a 
right turn into a large room. The featureless walls were painted 
jet black, and the lights were full on, giving the room a cell like 
appearance. In the middle of the room, slumped in her chair sat 
Elizabeth. Dumping Angela in the corner, Anne ran to 
Elizabeth's unconscious figure, "Elizabeth are you ok," Anne 
asked, checking Elizabeth's pulse. It was strong and regular. 
Elizabeth, however, did not look ok. Her hair was tousled, the 
area around her eyes was streaked with tears, but when all was 
said and done she looked uninjured. Anne breathed a sigh of 
relief. All she had to do is wait for Elizabeth to wake up.

She took a few moments to study the face of the daughter, she 
had only seen in magazine articles. Of course she looked 
exactly like she used to. Auburn hair framing delicate 
cheekbones, full lips, and even in sleep she had an aristocratic 
air about her. Anne gently gave Elizabeth's cheek an 
affectionate stroke. This was her daughter, a daughter she had 
left in the care of others worthier than herself, and a daughter 
she had never known. What would she be like? Would she be a 
smart, self-assured young woman as she was at her age, or 
would she be a timid little mouse? Anne knew that Elizabeth 
would be brilliant, but that was no compensation for not knowing 
her properly. Of course Elizabeth wasn't the product of a loving 
union, but of genetic engineering. To Anne, that didn't matter 
one bit. Anne imagined the baby Elizabeth in her cot, cooing, 
gurgling, and smiling at Matthew and Kat.  And she felt bitterly 
sad that she was not around to see it. Now Anne gave Elizabeth's 
hair a comforting and loving stroke. When Elizabeth awoke 
Anne would be forced to decide whether she lived or she died. 

Anne concentrated on her wrist and the dart tube retracted back 
into her arm. She then sat crossed legged on the floor, gun in 
her right hand, and waited for Elizabeth to wake up.

-- o -- o -- o --

Mark had spent the last few hours trying to forget the night 
before. How quickly his fortunes had turned around. One 
moment he was the luckiest guy in college, the next his girlfriend 
turns out to be a mass killer. No matter how he tried he couldn't 
get the images of her cutting down the gang in front of his very 
eyes out of his mind.  More than that, she had shown little 
remorse in doing so. Forget about Dr Elizabeth Anne Bexley 
being a reformed character. She was just as lethal as she had 
ever been, maybe not psychotic anymore, but deadly all the 
same. 

It had taken a lot of courage for her to admit who she was, but 
she didn't really have any choice after what she'd done. He 
would have sussed it out sooner or later anyway. Now he 
thought of it, all the background information he and Wills had 
got on her fitted in perfectly. No illness of any kind, her 
changeling organ could quickly deal with any infection. Her high 
intelligence, her extreme confidence in dealing with the boat 
accident, her parents being killed in an auto accident, and her 
taste in retro-music should have all been clues. But how could 
anyone still suspect that the infamous Dr Bexley was alive and 
well?

She had joked about only picking up men in broken down cars, 
and he'd thought it had related only to him, but no, clearly it 
didn't. He had to tell someone about this, his heart couldn't 
contain the hurt he felt, and he had to share it. Wills would know 
what to do. 

Picking up the phone he called Wills ,"Hi Wills, where are you? I 
need to talk."

"Right outside your door. Hey, you missed classes today. I was 
worried you ok?" Wills voice answered.

"Tell you when I let you in." Mark got up and opened the door 
just as Wills was walking down the hallway. Putting the phone in 
his jeans pockets he gave Wills a wave.

"Hi, wass up?" Wills asked.

"Take a seat and swear to God you won't breathe a word of this 
to anyone," Mark said softly.

"Ok, " Wills replied and sat down on the threadbare sofa.

"Anne and I split up last night," Mark said. It still hurt to think of 
it.

"Oh no! I thought you two were so right for each other. How 
come?"

Mark related the previous night's events to a stunned Wills. 

"So Anne was Dr Bexley all along, complete with changeling 
organ. Fucking hell, Mark you're lucky to be alive," Wills 
commented.

"I know, I kept expecting her to rip my head off, or turn me into a 
cheerleader or something. I've no idea where she is but I'm 
staying here until this all dies down."

"No, I didn't mean her. I meant the gang. If she hadn't 
been there you would have been dead on the pavement with a 
bullet in your head. She saved your life, Mark," Wills said in a 
matter of fact tone.

"I know, but she didn't have to rip people in two. That was 
before we broke up anyway." Mark was now feeling even more 
depressed. How could this happen to him?

"How was she when she left?" Wills asked.

"She didn't seem angry at me as such. Just sad that I didn't 
want to be with her anymore. She told me she loved me. If she 
had told me that before yesterday, I would be on an all time 
high. But now I feel as though my heart has been broken into a 
million pieces. She was so right for me Wills. Why'd it have to 
work out this way?" Mark was trying his hardest not to cry but 
his pain was starting to push through.

"When she told you about the Fury, did she seem sorry for it?" 
Wills asked.

"I can't tell. I was too much in shock," Mark admitted.

A thought occurred to Wills and he voiced it to Mark "You know. 
She could've begged forgiveness, tried the sympathy thing on, 
but it looks like she didn't. That says something to me."

"Yeah, like she was sorry she got caught!" Mark snapped.

"No, like she wanted to be honest with you. She wanted to show 
you who she really was, not manipulate your feelings to get 
what she wanted. She's lived her entire life being other people, 
now she only wants to be herself as best she can. Before you 
knew who she really was you treated her like that. With no 
pretensions, images or masks. From what you told me about 
your first date that's what she said she liked about you. You 
didn't try and be anyone else, just Mark."

"I really fucked up, didn't I?" Mark complained bitterly.

"That depends. How do you feel about her?" Wills asked.

Mark shrugged his shoulders "I don't know. Anne Baxter I fell in 
love with. Dr Elizabeth Bexley I haven't. Yes I know they are the 
same person, but last night, when I looked at her I didn't see 
Anne. I saw a fifty year old woman, who isn't strictly human, and 
who had just killed three people as though they were bugs to 
step on. That's a big change from the person I thought Anne 
Baxter was."

"I hadn't thought about the age gap," Wills admitted.

"I only just did. Sure, she looks my age, but in her mind and the 
way she acts she's just like my Mom! Sure, she wears the 
fashionable clothes and acts like a normal twenty something but 
all the way along there was a world weariness about her. I never 
really noticed it until you said, but it was little things. Like the 
way on her first date she acted as though she had seen it all 
before. I'd put it down to her having lots of dates, but now I know 
she HAS seen it all before. Fuck knows what she got up to when 
she was in the CIA.  I'll bet they used her for more than courier 
work. You know what? I don't really want to know. All I know is 
that I fell in love with Anne Baxter, and now she has gone 
forever!" Mark put his head down a little. It hurt too much to 
think about it.

-- o -- o -- o --

Anne sat there for the best part of an hour before she 
detected a slight movement from Elizabeth. She had taken the 
time to firmly restrain Angela, even though it would be several 
hours before she woke up. During that hour she had perfected 
what she was going to do and what she was going to say. Her 
backpack was on the floor in front of her, just in case. 

If she gave Elizabeth a clean bill of health just to enable her to 
pass the test, when in fact she would have failed, then 
somebody else would notice and kill her anyway. She was also 
sure that Heinlein would have a backup in case she chickened 
out. The only way to save Elizabeth was if she was to do it 
herself. 

"Who are you?" A nightingale like voice asked her.

Anne looked up and saw a pair of bright blue-gray eyes studying 
her intensely. The eyes checked out Anne's pistol and didn't 
show a sign of fear. It was just another obstacle to overcome 
before she escaped.

Anne so wanted to tell Elizabeth who she really was, but knew 
the shock would be too great. "You can call me Friday. And I'm 
one of the good guys," Anne discretely put her hand inside the 
open backpack and flicked on the voice recorder. If anything 
went wrong this would be essential evidence.

The blue-gray eyes looked at the unconscious Angela and then 
at the pistol once more. "Then why the pistol?"

"Insurance," Anne replied. 

"So why am I not out of here already?" the voice demanded.

Anne asked. "We have some unfinished business first. Elizabeth, 
how are you? What did they do to you?"

"They tried to make me join them. They told me all sorts of lies 
to convince me to abandon my family and my fiancée. They 
failed." The voice was cold and matter of fact.

Interesting, she shows no sign of trauma, Anne thought. Was 
this usual or a symptom of something worse? "It's ok, you're safe 
now. We need to wait until help arrives."

"How'd you find me? Where am I?"

Again the dispassionate nature of Elizabeth's tone worried her. 
"Doesn't matter how I found you, and you are in a farmhouse in 
England."

"You don't sound British! Friday sounds more like a codename."

'Smart Kid' Anne thought. "I'm not, I'm from the US 
government."

"Why are they involved?"

"Because of who you are?" Anne replied. Here it comes. How 
would Elizabeth answer?

"A celebrity? Wow that's VIP treatment for you. My very own spy 
to look after me!"

'Clever answer' Anne thought. Intuitive reasoning about the spy 
part too.  "No, I meant you being a direct copy of Dr Bexley."

Anne looked for a reaction, but didn't see any sign. Elizabeth 
was playing the game very well indeed. She was holding her 
cards close to her chest. It was as if she didn't trust the one sent 
to rescue her.  "Who's that? " Anne asked nodding towards 
Angela.

"My room mate. She tricked me into thinking she was my best 
friend, when all along she was plotting to subvert me. Set me up 
so that when she took me down I would fall even further. She's 
ruined my life! Is she dead?"

"No. I just stunned her," Anne said. Crunch question number 
two she thought.

"Pity," was the icy reply.

Anne started to get worried. Kat would have drummed into 
Elizabeth the sanctity of life, all life from an early age. The cold 
heartless way Elizabeth answered didn't reflect that teaching 
one bit. "Why 'pity.' Surely she deserves a fair trial?"

"Yeah right. She fucked up my life. Fucked up my marriage to 
Alex, and arranged to have me kidnapped. Why shouldn't she 
die!" the voice sounded harder still.

'Now we are getting somewhere', Anne thought. She pressed in. 
"I agree with you. There's only you and me here and I won't tell 
anyone. What do you want to do with her?" Anne saw a look of 
fury flick across Elizabeth's face and her heart sank. Things 
were not looking good for Elizabeth.

 "I can't tell you what I want to do with her. That's between her 
and me. Why can't you untie me?" was the reply.

"First rule of business. Trust no one. You could be anyone. An 
imposter waiting for me to untie you before you strike. No, you 
can stay as you are," Anne replied.

"Hello, mother," the voice said softly.

Anne was staggered. How in hell did Elizabeth work that out? 
She had given no clues as to her identity at all. She knew 
Elizabeth was quick at deducing information because she was 
as well, but the speed of that deduction from her was scary. Had 
she underestimated Elizabeth? She decided to play dumb, 
"Sorry?" 

"Oh come on. Let's not fool around anymore. You know who I 
am and I know who you are. I think like you do, remember. But in 
case age has addled that brain of yours here's how it goes. You 
would never commit suicide in a fit of self pity, would you? Your 
changeling abilities would be far too useful for the government 
to ever let you go free, so you're working for them. You wanted 
the chance to see and save the life of your long lost daughter so 
you offered to come and get me. I've long suspected you were 
still alive. That was the only logical conclusion from my research 
into the aftermath of the fury directive incident."

Anne spotted Elizabeth's flaw in reasoning. That was good, she 
needed an edge. Elizabeth was sharp, probably sharper than 
she had been at her age. The only way to move forward was to 
try and put her off balance "What have you done with 
Elizabeth?"

"You are losing your touch, mother, aren't you?" was the slightly 
mocking reply. 

'Fuck she IS sharp!' Anne thought. Elizabeth hadn't even 
flinched with surprise. Anne knew that something was up with 
Elizabeth, that the kidnapping had taken its toll, but there wasn't 
enough evidence, only a suspicion. If Elizabeth was ok, why did 
she just sit there and trade cryptic answers? Anne thought it 
was like two chess players seeking to out maneuver the other, 
but why was Elizabeth playing the game at all?  

Elizabeth saying, "Why didn't you visit me? I'm sure Matthew and Kat 
would have wanted you to," interrupted her train of thought.

Anne spotted the trap. If she gave her reasons she would 
confirm Elizabeth's suspicions. If she denied them then she would 
fall deeper into the web of veiled meanings that Elizabeth was 
weaving. The further she allowed herself to be dragged in the 
less likely she was to get the information she wanted. She knew 
Elizabeth was trying to muddy the waters for her, but for what 
reason? The only way to win was to change the rules. She 
stood up and standing in front of her concentrated. She felt her 
body shift and flow around her and within a few seconds stood 
in front of Elizabeth in her new form.

"Very impressive. So you do admit to being my Mom then?" the 
voice sounded surprised, but also a little smug, as if she had 
worked out how a magician performed a certain trick.

Anne sat down once more. It was odd to be back in the shape of 
her old Elizabeth Bexley body, but she didn't have time for 
feeling odd, time was running out. It was time for a different 
approach. "Yes daughter, it's me. I had to come. I'm sorry I 
stayed away for so long but I had no choice," Anne's tone was 
soothing and all trace of confrontation had gone.

"I know. They made you stay away. Why did you try and trick 
me?" 

Anne decided to play on Elizabeth's paranoia and lack of trust. 
During their little maneuverings Elizabeth hadn't thanked her 
once for rescuing her, hadn't trusted her enough to really 
demand to be untied, and had been so wary of her motives that 
she had refused to be drawn into any subject. Only the slight 
slip about Angela had revealed anything was wrong at all. 
Even then someone who didn't know Kat's thoughts on killing 
would think that was a natural reaction for someone in her 
situation. It was also telling that Elizabeth had displayed no 
emotion during this time. It was as though somehow she was 
disconnected from the whole thing. This all meant that Elizabeth 
didn't trust anyone, now it was time to play on that distrust. "You 
don't know the number of times I wished I could have been 
there for you but I had to stay away. I had no choice."

"We always have choices," was the guarded reply.

Anne smiled inwardly. It was working, "Not always."

"Why haven't you let me go yet? Why all the questions? Are you 
testing me?" 

Anne smiled. That was the breakthrough she was looking for, "I 
want to see if you are worthy."

"Worthy of what?"

"Of me," Anne said. It was natural Elizabeth would compare 
herself to her. A question Elizabeth would have asked herself 
over and over again was 'Am I like my mother?' The question 
she had just asked was designed to play on that and maybe 
draw something out. 

"What do you have in mind?"

Anne smiled inwardly. Gotcha! Now it was time to go to work! 
"Why should we be apart? Why not join together as mother and 
daughter. Just think what we could achieve together!" 

A smile flickered across Elizabeth's face for the first time. "What 
do you have in mind?"

Anne's plan was working. She had been giving veiled pointers to 
Elizabeth, feeding her paranoia, her desire to dominate any 
adversary, and her desire to know more about Anne. By playing 
to these needs Anne was building Elizabeth's confidence that 
she could be trusted. Now was the acid test, "I think it's time we 
took back what was ours. For the last thirty years I've had to 
play miss goody two shoes and it's worn very thin. On my own I 
made too many mistakes. Getting the Guild involved was my 
biggest. With you and me, we don't need the Guild or the Children 
of Bexley. What a bunch of amateurs they are! We only need 
each other."

"You're worst mistake was not killing them all when you had the 
chance. You were too merciful."

Inwardly Anne cringed. She had drawn out of Elizabeth what 
she had feared and suspected had happened. She was too late. 
Elizabeth had been corrupted by whatever this Angela had done 
to her. Could Elizabeth be turned back? If so, then she didn't 
need to die. "I see that now. I still hate them, Matthew, Kat and 
Cathline. They drove me away, forced me to work for the 
government and not have a life of my own. I've been a fucking 
prisoner for thirty years. Dr Bexley do this, go there, kill that 
person, deliver this package to so and so. I'm as much a 
prisoner as I was when I was in the ocean. Maybe more so. But 
now you have the chance to free me. That's why I wanted to 
come. Beloved daughter, you are the only person who can free 
me. I'll do you a deal. You free me and I'll free you and we'll go 
after those who have harmed us together."

"No deal," was the icy cold reply.

'Fuck' Anne thought. She'd blown it. Elizabeth wasn't convinced.

"I want to deal with them all. You can have them after me. I want 
to deal with Matthew, Kat, John and Cathline. They've lied to 
me, robbed me of my happiness with Alex and ruined any 
chance of happiness I had. They deserve what I'm going to do 
to them. I've worked it all out too!"

Anne's heart sank. She really was too late. But just how far had 
Elizabeth gone? "Before we go into specifics I'm not called 
Elizabeth. Elizabeth was the doctor who helped people. Please 
call me 'Lizzy' or Mom. I dealt with my own 'Elizabeth' a long 
time ago. Who are you?"

"You can call me Deianeria," Deianeria replied. She was so glad 
that her mother had returned to help her. She had been uneasy 
at first. Unwilling to show herself, and if anyone else had been 
there to 'rescue' her she would have pretended to be Elizabeth 
forever. Her mother had spoken the truth. Truly she had been 
deceived and abandoned once more. Well, together they would 
get their own back. She felt overjoyed. It was supposed to be 
like this. This 'Lizzy' her mom had talked about had done the 
same thing as she had to prissy Elizabeth a few hours ago. 
Thanks to Angela she was now free of her and soon thanks to 
her mother she would be free to pay back those who had ruined 
her marriage to Alex. Deianeria relished the thought of bringing 
her own mother into her previously private world. The thought of 
sharing turned her on. 

Anne asked, her voice mimicking Deianeria's cold 
dispassionate tone, "What are you going to do with them? Tell me 
everything. Let me know what you are planning, so I can help. 
Nothing is too bad for them. Thirty years of pain and all because 
of them!"

Deianeria smiled. "You'll like what I have planned for them. After 
you rescue me and return me to my no doubt overjoyed 
parents I'll wait a while just to let them know I'm ok. A small 
amount of sedative in a celebratory drink will do just fine and 
then the fun begins. I want to do this alone, but don't worry, I'll 
record the entire thing! We can watch it later on, together!"

Inside her Anne felt sick. This Deianeria sounded so much like 
she used to at the height of the Fury. Was this what people were 
afraid of in her? "Then what happens?" she asked.

Deianeria's blue-gray eyes lit up. She could feel herself getting 
aroused at the thought of what she was about to say. It's a 
shame her mother didn't seem in the mood for a mother-
daughter reunion. Maybe later. "Then I take them all down to 
Stephanie's cove. I've got everything all laid out for them. 
Chains for Matthew and John, a nice large bed for Cathline, Kat 
and me. Finally I would bring down Matthew's pistol to ensure 
everybody does as they're told. Oh and a nice knife too, just 
in case. I would then chain Matthew and John to the wall and 
then Kat and Cathline to each other. You remember how much 
Cathline wanted to be with Kat again? Well this would be her 
chance. Here's how I see it going."

        "Elizabeth unchain us at once," Kat will demand.

        I'll reply, "No way. I'm sure Cathline here doesn't want to 
        be untied do you Cathline?" 

        "Elizabeth why are you doing this to us? What in hell do 
        you think you are doing?" Cathline will squirm and try, 
        and free herself from her chains. In doing so she'll 
        rub against Kat's naked body, her breasts will gently 
        stroke Kat's. From my vantage point above them I can 
        see Cathline's nipples become erect and I'll know she's 
        getting turned on.

        Matthew is shouting at me to unchain him and John. He 
        tries to escape, but it doesn't work. I've done my job too 
        well. I'll say to him "Don't worry daddy I'll be there soon."

        I'll turn my attention to Kat and Cathline "Now here's how it 
        goes. Cathline you've always wanted another chance 
        with Kat, so now I'm giving it to you."

        "No fucking way!" Cathline'll swear at me, her voice full of 
        venom.

        "Yes, way, Because if you don't then I will shoot one and 
        leave the other one alive. Her death will be on your 
        hands. If I think you aren't performing, as you should; 
        then the result will be the same," to emphasise the point I'll
        ram the pistol down Cathline's mouth and fingered the trigger.

        "Elizabeth, I thought you loved us. We love you," Kat is 
        starting to cry now. She knows I mean what I say after what I
        just did to Cathline.

        "You should have thought of that when you all decided to 
        hide the fact that Alex was my brother from me, shouldn't 
        you!" I then pulled the gun out from Cathline' mouth and she
        gave a sigh of relief. I won't kill you just yet Cathline, I
        think to myself.

Anne was shocked. So that was what they used to turn 
Elizabeth into this monster called Deianeria. This was a new 
development! She was tempted to interrupt Deianeria but decided 
against it. She needed to see just how far Deianeria would go. 
Again the question, was she ever this cruel?

Deianeria continued fantasizing, oblivious to what was going on 
around her. It didn't matter if her mom listened in. She was part 
of it now, she'd understand, and maybe she'd even join in! 
Deianeria tried to feel her pussy but couldn't reach it, "Mother 
rub my cunt. I'm so horny please," Deianeria pleaded.

Anne's feeling of revulsion grew. She wanted no part in this but 
for Elizabeth's sake she had to be sure, "What happens then?" 
she asked.

Deianeria gave Anne a seductive smile. Her mother was playing 
hard to get, but that didn't matter. For now, only her fantasy 
mattered. 

       "We're sorry. We thought it best," Kat will start to say.

       "Kiss her bitch, fondle her tits, and put your finger in her 
        cunt. Otherwise Cathline dies!" I'll shout at Kat.

        Gingerly Kat gently kisses Cathline on the lips and puts a 
        hand on her breast. Kat isn't trying, so I fire a shot just 
        above Cathline's head. She gets the message after that. 
        Cathline does too. A few moments later they're kissing 
        passionately and touching each other's pussy, tits and 
        ass. After a few minutes they're starting to get into it 
        and I feel myself getting turned on just by watching them. 
        I so want to join in, to rub my hands up and down Kat's 
        slim, lithe body and plunge my fingers into her wet pussy 
        but I know I can't. I think to myself that maybe I will keep 
        Kat alive, as my plaything and my slave. I can hear their 
        moans start to fill the cavern. Matthew and John are 
        looking on with disgust, but their erect cocks tell me they 
        are getting turned on too. Dear Mother men are so easy 
        to read aren't they?

        By now Kat and Cathline have fully embraced each other 
        and are kissing and caressing as much as their chains 
        will allow. They beg me to loosen them so they can go 
        further but I know what they are planning. I hear Kat 
        moan like she does when Matthew is fucking her and that 
        pleases me. She's not holding back. Cathline is moaning 
        too, actually it's more like a gasp. I've never heard 
        Cathline being fucked before, so I can't tell if she's acting 
        or not. But as I stand and watch Kat put two fingers inside 
        her cunt and move them in and out I know she's not 
        faking either. Their gasps come quicker and quicker and I 
        know they are reaching climax together. I feel so wet in 
        my pussy that I just have to get some relief. I take off my 
        skirt pants and knickers, and run my fingers around my 
        clitoris. I then take off my blouse and bra so I am now 
        naked and feeling very horny. My moan's mixing in with 
        those of Cathline and Kat drive me wild. Pleasure is 
        rushing up and down my body, fanning out from my 
        pussy and onto my breasts. Unable to hold myself back I 
        drop the gun away from them and jump onto the bed 
        sitting firmly on both of them, so that they can't get me. I 
        stroke their backs and their smooth asses. Fuck Cathline 
        has a good body. I can see why you designed it like it 
        was, mother."

Anne felt sick inside. Were there no depths to Deianeria's 
depravity? Had she ever done anything like this? Yes she had! 
She had done it with Cathline and a partially female John, in her 
pool. She had let John fuck her whilst licking Cathline out. So 
much of what Deianeria was thinking about doing she had 
thought as well!  Deianeria continued fantasizing and Anne 
listened, desperate to see any kind of ray of light for Elizabeth. 
However, she knew that she was clutching at straws, whatever 
was going to happen to Elizabeth, she was too late to prevent it.

        "I can feel our body's start to quiver as we build up to 
        climax. I can feel a finger touching my Clitoris, gently 
        caressing the nub of flesh around my pussy. I look to see 
        whose hand it is, it's Kat's, and boy, does she know what 
        she's doing! We are all gasping with pleasure now, faster 
        and faster and faster, until with a scream of pleasure I 
        come. I get off the bed, trying to ignore the moans from 
        the bed begging me to come back. They get back to each 
        other and I see the ripples of pleasure go thru their 
        bodies as they come, Kat first and then Cathline. They 
        lay back, exhausted from their love making and look at 
        me expectantly.

        "Now what should we do with you two?" I say turning to 
        Matthew and John. I can see their erect cocks waiting 
        expectantly. In spite of their protests they were turned on 
        at the sight of Kat, Cathline and me having sex. My pussy is 
        still moist and wet and it demands cock. 

        "No Elizabeth please let me go," John pleads. John was 
        the first to speak, so he is the first. He is unable to move 
        from his spread-eagled position, so I move seductively in 
        towards him. I feel his large firm cock, and stroke its 
        length. It's a good size, firm and stiff. I open my legs, 
        stand on tip toes, and thrust it inside me. I can feel it's 
        warmth inside me, and I clench my pussy muscles, 
        clamping onto its girth. I then move, thrusting my hips into 
        his again and again I feel it slip in and out of me. I start to 
        moan once more. John is trying to pull it out of me, but he 
        can't move. I rub my breasts against his chest and into 
        his face, and feeling the rough hair on his chest rub 
        against my firm bosom makes me feel even sexier. I 
        speed up my rhythm until John can't help but come inside 
        me. I can feel his warm wet cum in me and feel it start to 
        seep out. But you know mother, I'm saving the best till 
        last.

Unseen by Deianeria Anne flipped the safety off her pistol and 
then listened to Deianeria continue.

        Matthew's cock has gone flaccid. That's no fun at all! I 
        bend down and using my mouth and tongue I start to 
        caress it. In spite of Matthew protesting his body's instinct 
        kicks in and his cock starts to rise. I give him a seductive 
        smile and put his large dick in my mouth. I grip it with my 
        mouth and move my mouth backwards and forwards, 
        until I feel Matthew's hard erection in my mouth. Before 
        he can get it to react I push myself into Matthew. Like 
        John he tries and resists, but I've got him chained too 
        tight. His dick is just like Johns hard, warm and firm. I'm 
        so moist and turned on now it slips right in me. Matthew 
        is hurling abuse at me, and trying to push himself off me, 
        but he can't do anything to prevent me ramming his cock 
        into me and gently rocking back and forth. So this is what 
        it felt like to be screwed by Matthew. I'd wondered what 
        you felt ,and now I know. It feels so good. His cock is 
        brushing up against my clit and I can't help but moan out 
        loud. Kat and Cathline are protesting, but all they do is 
        make me more turned on. I'm now pushing in and out so 
        fast I can hardly keep him in me. I am so near to coming 
        once more it hurts. I thrust him into me again and again 
        until I feel his cock start to throb inside me. I pull myself 
        out of him and feeling my warm moist pussy I finish 
        myself off. 

        Matthew is in tears. I know I've broken his heart and that 
        alone pleases me. "My mother made you a woman years 
        ago, and you know what they say, like mother like 
        daughter. I hope you enjoyed that fuck Matthew, because 
        it was your last as a man! You're not going to be a full 
        woman, just my sissy slave who I will dress up in pretty 
        dresses, and I think your hair could do with some 
        restyling. But first this.

        I walk over to the knife, pick it up, and pressing Matthew 
        against the wall I move the knife over top of his balls and 
        cock. Holding them with one hand I slit around his left testicle --
        his screams of pain is like music to me as I cut round it and pull
        it away. I stop the bleeding quickly and then, gently run the
        scalpel down his bleeding cock, creating bloody slits in it as
        I go. Matthew is screaming and screaming in agony and this turns
        me on even more.

	Finally when his cock and ball is in bloody tatters I push the
        knife down. Matthew screams in pain as I rip his cock and remaining
        ball off and show it in front of his face. Kat is screaming at me to 
        stop but it's now no good. I quickly patch up the wound 
        leaving him with a nice girlie slit. It's crude but it will do 
        until I can do a proper job on him. Matthew has passed 
        out in shock.  He will have another shock when he wakes 
        up. I've brought some corsets in especially for him. Soon 
        he'll have his hourglass figure back, just as he used to. 
        He should be used to wearing dresses by now; maybe I'll 
        make him my sissy maid. I like the sound of that.

        I turn my attention to John. He struggles to resist but I'm 
        too strong for him when he's all tied up. I say to him, 
        "Don't worry brother dear. Matthew lived as a girl for 
        years, he'll show you how. I've got a nice set of dresses, 
        skirts, bras(yes, you'll need them too) and blouses you 
        can share with Matthew. We'll have so much fun dressing 
        up together and sharing clothes, just like sisters! Actually 
        it should be Mandy now. John is still screaming as I sever 
        his penis and scrotum, and again show him it. I work 
        quickly to stem the blood flow and soon he has a nice 
        crude pussy the same as Mandy's. He blacks out under 
        the shock and pain but that's ok. I'll give him the first of 
        his hormone injections while he's out. I've always wanted 
        a sister and now I've got one. Maybe he'll learn how to 
        please a man in some Asian brothel. Yes mother, that's 
        what I'll do to him!

        Kat and Cathline are screaming abuse at me, begging 
        me to stop but it's too late. There are now two extra girls 
        in the Stephens family. I can't wait until Mandy and 
        John's, sorry, Janet's waist starts to narrow and their hips 
        start to grow. They'll look so cute together, and as for 
        when Janet's titties start to grow think of the fun we'll 
        have trying out bra's together!

That's where you come in dear mother. You can choose 
which of them you want for yourself. I want Kat and 
Janet. I think you'll like how Mandy is going to turn out. 
I've got it all planned. What about Cathline, I hear you 
say? I'm sorry but you can't have her. She's the one who 
didn't tell me about Alex, so she has to die. I know you 
wanted her but Mandy should be enough for you. I'm 
going to take the still bloody knife, and ram it up her cunt 
and slit upwards with all my strength. She'll scream as 
the knife digs into her and as I run it up her perfect body 
she'll pass out from the blood loss. I'll keep Kat chained 
to her and make her watch as Cathline slowly bleeds to 
death in front of her."

Anne had heard enough. Nothing she could say would be able 
to stop Deianeria from carrying out what she had just described. 
Her daughter, the real Elizabeth was gone, snuffed out by 
Deianeria. The extent of Deianeria's revenge had shocked her, 
and yet it was nothing she hadn't thought of. Or even done 
herself. Had she really been that bad? Yes she had, she had 
taken the cult leader apart organ by organ while he was still 
alive and with no anesthetic. She knew she had done wrong in 
the past, but hearing Deianeria speak it with such glee and 
sexual excitement really bought it home. No wonder Mark ran 
away from her. She checked her watch, it was now time to put 
her alternative plan into action. She knew that in the days, 
weeks and maybe months to come this moment would come 
back to haunt her but Deianeria had left her with no choice. 
Deianeria had killed Elizabeth not her and now it was time to put 
her desperate plan into action.

"Come now daughter let's go. I can't wait to fuck Mandy," Anne 
crooned. She moved over to where Deianeria was seated and 
undid the straps. 

"Thank you mother. I know you'll enjoy enslaving Mandy." 
Deianeria tried to stand up but hours being 
strapped to a chair had made her legs weak. Anne helped her to 
her feet and after a few moments Deianeria was able to stand 
up properly.

"After you daughter," Anne gestured and indicated for Deianeria 
to leave first.

Deianeria gave a sweet smile "Why thank you mother and 
turned to leave.

Anne took a deep breath "Daughter?"

Deianeria turned to face Anne.

"Goodbye my love," Anne said softly, her voice full of regret and 
compassion. She then took precise aim; she would only get one 
chance, and fired the pistol into Deianeria's chest. The silenced 
pistol made a 'phht' sound and for a few seconds Anne thought 
she had missed as Deianeria stood looking down at her chest in 
shock. She then looked up her eyes wide with surprise and 
betrayal, Before she could do anything else she collapsed to the 
floor blood seeping out of a small wound in her chest.

Anne ran to her backpack and took out her sat-phone. She 
made a hurried call to the emergency services before walking 
over to Angela. She aimed at an oblique angle at Angela's 
shoulder and fired from a few meters away. Angela's body 
twitched with the impact but she didn't wake from her inert state. 
Anne checked the bullet wound and pulled the paralyzing dart 
from Angela's body. After untying Angela, she placed the gun in 
Angela's other hand. When the police arrived they would think 
there had been a struggle, and Angela had shot Elizabeth as 
she tried to escape. Anne had thought about killing Angela, but 
she had seen too much death to last a lifetime. For once she 
would be merciful and let the authorities deal with Angela. 

She turned to look at Elizabeth's body on the floor, the flow of 
blood had stopped and all color was draining out of the body. 
She checked the pulse but could find none. A wave of deep 
sorrow crashed over her as she realized what she had done. 
She walked over to Elizabeth's body, cradled it in her arms and 
wept and wept over her fallen daughter.

-- o -- o -- o --

Alex was waiting by the phone in his Cambridge hotel room. Kat 
was only six hours away and Cathline would be here in the 
morning. There had been no news from the kidnappers at all, 
which had surprised the police as usually demands are made as 
soon as the kidnap is made known.  He had tried to remain 
strong for Kat, but inside he was desperately worried. He and 
Elizabeth had grown so close over the months they had been 
together. How cruel would it be for their love to be denied? 
Frustration was starting to creep in, he felt powerless and at the 
mercy of the fates. There was nothing he could do except wait 
and pray. He'd tried watching TV but every cop show or drama 
only served to rub salt in the wounds. The comedies he couldn't 
laugh at and even the Kweepa and Rooney movie on pay per 
view seemed puerile and pointless. Frustrated and bored he lay 
back on the bed and thought back to the fun times he and 
Elizabeth had had. The first date was one of the most 
memorable. It was as near perfection as he could have 
imagined. It was, however, the day he had asked her to marry 
him, which stuck in his mind. It hadn't been a grandiose affair. 
He had proposed to her over a simple meal at his house; he 
wanted the moment to be a special one and not contaminated 
with fancy meals or venues. She had taken one look at the ring, 
a simple diamond and gold affair, and said "You really expect me 
to marry you after the lifetime of grief you caused me?"

His heart had sunk at the sound of this. He had blown it. A laugh 
from the other side of the table made him look up. Elizabeth had 
placed the ring on her finger and was inspecting how it looked 
on her hand. She smiled. "Alex, Yes I will marry you," and they 
had embraced, both wishing that moment would never end.

There was a sharp knock on the door and Alex swung his legs 
out of the bed and answered it. Inspector Jones stood there and 
was accompanied by another police officer. "Hi Inspector. Any 
news?"

"Can I come in?" Inspector Jones said. He pushed his glasses 
back onto his nose as if trying to avoid saying something. 

"Sure. What's going on?

Inspector Jones turned to his fellow officer and said "Bob put the 
kettle on for us please. Mr Richards, please take a seat."

Alex's desire for news turned to apprehension. Inspector Jones 
didn't look at all happy to be there. It was as if he had to perform 
the worst job in the world but Alex sat down as instructed.

"Inspector what in hell has happened?" Alex demanded.

"Elizabeth's been found. She was in a farm house in Yorkshire," 
inspector Jones started to say.

"That's great! Is she ok?" Alex interrupted.

"I'm afraid not. She was shot in the chest at close range during a 
struggle with her kidnapper. It looks as though she was shot 
trying to escape. We have the kidnapper in custody."

"How bad is it?" Alex asked. He hardly dare ask but he had to 
find out. 

"Very nearly as bad as it can be. She's in St Lukes hospital 
Huddersfield. She's in a critical condition with severe damage to 
her heart, lungs and she was bleeding internally. At the moment 
the only thing that's keeping her technically alive are the 
machines. That's all I know. We have a car waiting for you if 
you'd like to go there. It'll take a few hours but the doctors don't 
expect much change in her condition. I'm sorry Alex, I really 
am."

Alex sat there stunned. The woman he loved, the woman he 
was going to marry and his 'soul mate,' was virtually dead. 
Elizabeth's life hung by the slenderest of threads and he was 
powerless to do anything about it. "Do Matthew and Kat 
know?" Alex managed to say. 

"We called them before we came here. Matthew's on his way 
here now but it will be a number of hours before he gets there.  I 
would suggest you try and get some sleep in the car."

Alex nodded and took the cup of strong sweet tea that the other 
police officer had just made him. He took a sip and swallowed 
the warm, sweet liquid. He knew the real motive behind the 
drink; they were treating him for shock. Putting down the cup of 
tea on a nearby table he collected a few things and put them in 
his bag. He wouldn't bother to check out. He'd settle the bill by 
PDA later on.  He was escorted outside and got into the white 
and yellow striped Rover-Proton police car. He suddenly felt 
very tired and was soon fast asleep.

-- o -- o -- o --

From her vantage point above the farm house Anne had 
watched the ambulance take Elizabeth's body away, closely 
followed by a still unconscious Angela. Police had stormed into 
the house and soon made it difficult for Anne to stay around and 
watch. She had sprinted the kilometer back to her car and had 
deduced they would take Elizabeth to the best and closest ER 
possible. It took her about twenty minutes to drive into 
Huddersfield and she tried a couple of hospitals there before 
locating St Lukes. 

She shifted form into a five foot five brunette and quickly located 
the laundry room. No matter where she went all hospitals were 
the same. From Adelaide General where she'd lain comatose 
and near to death to her fathers hospital the layout, atmosphere 
and attitude was all the same. She quickly found a clean nurse's 
uniform, and checking that the coast was clear she put it on. She would 
ask Heinlein for a valid ID later on but for now the uniform would 
do, as in her experience most people didn't even check for a 
badge. In an overworked hospital who'd notice an extra nurse?

She quickly located the intensive care room and slipped inside. 
Looking at the array of equipment, she was impressed. She had 
expected to find older less effective hardware, but this looked 
brand new. She checked each bed in turn and saw Elizabeth 
lying in one, in a side room. Her skin had a pallor of death and 
the monitors showed that she was barely alive. Anne touched a 
few of the displays in order to get more information. Given the 
circumstances, Elizabeth's condition was as good as she could 
have hoped for. The monitors showed that her heart had ceased 
working on it's own an hour ago and was now being artificially 
stimulated by the machines. Both her lungs had failed and she 
was now on artificial ventilation. Brain activity was almost zero, it 
was borderline as to whether Elizabeth was technically alive or 
not. When they got there Matthew and Kat would need to decide 
whether to turn the machines off or not. It was not a decision 
she would want to make herself, but she had done so when 
she had shot her. She now wished there had been any other 
way, but the way she had chosen had been the only one left 
open to her. 

Anne walked over to a series of X-rays and scans pinned to the 
wall over Elizabeth's bed. To her relief it looked as though she 
had hit exactly where she had intended. Using her changeling 
organ she could manufacture and inject Elizabeth with a serum 
that would gradually repair the wounds, as she had done years 
ago with Detective Tina Cox but Elizabeth probably wasn't 
strong enough to cope with even the smallest dose. For the 
moment, it was now down to Elizabeth to cling onto the tiny 
fragment of life that remained in her.

"Can I help you?" A deep voice sounded from behind her.

Anne whirled round to see a tall man with glasses and thinning 
hair. "Sorry?"

"Can I help you? I don't recognize you. What are you doing 
here?" The doctor asked.

Anne used the response she had prepared for such 
eventualities, "You were a few nurses short for the night shift so 
they asked me to transfer from the Royal for tonight. She's a 
very ill young lady isn't she?" Anne said, nodding towards the 
inert Elizabeth.

The doctor gave Anne a suspicious look "She wouldn't be here if 
she wasn't!"

Anne decided to ignore the barbed comment, "I've seen the 
readouts. How much can she support herself? Is it just the 
machines?"

The doctor nodded sadly. "Apart from the barest flicker of brain 
activity it's the machines. She's in a deep coma and in my 
opinion is likely to remain that way."

Anne wasn't so sure about this doctor's opinion. "I'm surprised 
the gunshot wasn't fatal."

"It effectively was. It was a hell of a shot though. It went into the 
chest cavity splintering a rib. The bullet then passed thru her left 
lung puncturing it before coming to a stop just before her spinal 
cord. A centimeter further on and she would be paralyzed, not 
that it matters much now."

Anne knew the answer before she asked but she needed to 
gain the doctor's confidence, "So how come there's so much 
internal damage?"  

"The rib shattered, sending bone fragments into her other lung, 
superior Vena Cava and supraventricula crest. We've managed 
to patch her up by microsurgery but there was too much 
damage to do anything else. It's down to her parents now. It's 
their call."

Anne nodded "Thanks Doctor. What do you want me to do?"

"There's a patient in the second IC ward, change the biofilter for 
us."

"OK," Anne replied. Although things had gone as well as she 
could have hoped for, for Elizabeth's sake she wished she 
knew Kat better.. She was tempted to come back when they arrived 
but she needed to report back to Heinlein. She would stick around for 
a few days to make sure things were progressing as she wanted them to. 
Besides, she needed to pay a visit to Angela.

-- o -- o -- o --

A few hours later Kat came running into the intensive care ward. 
Alex had fallen asleep next to Elizabeth, his hand was still 
holding tightly onto hers. The array of tubes and machinery 
around Elizabeth scared Kat but it was Elizabeth's ashen gray 
appearance that caused her the most concern.

"Mrs Stephens," a voice said from behind her.

Kat turned around, her eyes streaked with tears. "Yes, doctor."

"Please come with me," the doctor replied.

"What about Alex and Elizabeth? I can't leave them," Kat 
pleaded.

"There's nothing you can do for her and he needs his sleep. 
He's been here for hours talking and holding her hand. Please, 
Miss Stephens, follow me."

Kat was led into a side room, and sat down on one of the plastic 
chairs in the room. 

"What have you been told?" the doctor asked.

Kat, still numb with shock and worry answered as best she 
could  "That Elizabeth is extremely ill and the it's the machines 
that are keeping her alive."

The doctor nodded. He hated this part of his job most off all. 
Especially when they were young and had a whole life in front of 
them, "It's not the time just yet, but we need to think long term 
about Elizabeth, what's best for her. There comes a point, which 
we are not yet at, when it becomes pointless to prolong her life 
any longer. We can keep her heart beating, her lungs working 
and the rest of her body functioning indefinitely but there is very, 
very little brain activity. It's being fed oxygen and as far as we 
can tell there is no physical damage but we are facing the very 
real probability that she may never recover from her coma. 
Sometimes the body just shuts everything down and forgets to 
come back again. From where I'm standing and based on years 
of experience, it looks to me as she will never come back to us. 
The injuries and blood loss are just far too great."

Kat tried her best not to cry. Elizabeth would tell her not to be so 
silly; to be strong for her, Matthew and Alex. But Kat couldn't 
help but feel deep despair. Wiping away a tear from her eye she 
asked "What are you saying doctor?"

I'm saying that you need to start thinking about how long you 
are prepared to wait before we switch everything off and let 
Elizabeth die peacefully and without pain. It's a choice we need 
to make together based on her condition. All I'm asking is that 
you and your husband give it some thought."

"I can tell you right now. I forbid you to switch off those 
machines! Not now, not ever!" Kat snapped.

The doctor nodded. "Ok, but every day she lies there she is 
using resources that other people desperately need. She's too ill 
to move or be unplugged. Sometimes it's better just to let go." 
The doctor put a comforting hand on Kat's.

Kat looked up and wished that Matthew were here.  

-- o -- o -- o --

Anne had called Heinlein in her car and told him what had 
happened. She was now in a bitter argument with him over her 
failing to kill Elizabeth outright.

"The fact remains that you were ordered to kill her if she failed 
the test. I've got another team on standby. They'll do the job you 
failed to do. In all our years of working together you never 
fucked up this badly. You did this on purpose!" Heinlein shouted 
down the phone.

"Too right I did it on purpose! I needed to give Kat, Matthew and 
the rest of the family time to say goodbye. I never got the 
chance with my parents and I'm dammed if I'm going to put 
them through what I went thru. You've seen the medical reports. 
She's not going to wake up, and in a month's time, after they've 
said their good-byes, they'll switch off the machines and let her 
die in peace with her family all around her. Isn't that so much 
better than leaving a dead body in an old farmhouse with a 
bullet thru the skull?"

There was a pause as if Heinlein was considering all the 
options. Anne knew he was consulting the medical report in 
front of him. "Ok, I'll call them off."

"When can I expect my hospital ID?" Anne asked

"You'll get it tomorrow morning. Dr Anne Williams, just 
transferred from Addenbrooke's this week right?"

"Yep."

"One more thing," Heinlein demanded.

Anne was getting well and truly pissed off with being ordered 
around. Especially when those orders involved her shooting her 
own daughter, "What!" she said sarcastically.

"What the fuck did you do to the cult leader? It took my clear up 
team three hours to sort the mess out. Consider yourself warned 
on that one. Also, if you pull a stunt like you did with that gang a 
few days ago  I won't be able to bail you out. It took a hell of a 
lot to persuade the police to drop the case. As of now you kill 
anyone again and I won't be there to get you off."

"I'm not planning to, unless it's in self defense," Anne snapped.

"Screw self defense! There are other ways apart from 
decapitation, dismembering and disemboweling!" Heinlein 
snapped. The police had demanded to know what creature had 
killed those gang members, and he had had to use all of his 
persuasiveness to get them to drop the case.

"That's not what you said when you made me assassinate 
Ambassador Putin is it? What was it? Use whatever force you 
must," Anne snapped back. She had hated assassination 
missions. 

"Just don't do it again," Heinlein said as firmly as he could.

"Fine! Oh, and Heinlein?" Anne said.

"Don't call me a bastard yet again," Heinlein replied. "That 
joke's wearing a little thin."

"I'm not. I'm just going to say that if you ever call me again, if 
you send in your goons to kill Elizabeth off before Kat and 
Matthew allow it, I'll come after you. You know there's nothing 
that can stop me if I put my mind to it. If I do have to come and 
get you then what I did to the Bexley cult leader will be like the 
Disney matinee version. Capiche?" Anne's voice was a deathly 
whisper.

"Don't you threaten me, freak!" was Heinlein's agitated reply.

"It's not a threat, it's an absolute certainty. Goodbye!" Anne 
disconnected the call. She would drive to a hotel and book 
herself in. She needed to stay close by for a while. 

She sat back in the car seat and allowed herself to cry. Why 
hadn't she thought that Elizabeth would be in danger earlier? 
Why hadn't she dealt with the Bexley cult earlier? Did she have 
any choice but to shoot Elizabeth?  A thousand questions 
bombarded her. What if she'd met Elizabeth sooner? What if 
she had let Deianeria live? What if she had killed Angela? 
Would Mark want her back? Did she even want to go back to 
him? These and many more questions flooded her mind and threatened 
to overcome her with guilt.  She found tears helped relieve the 
pressure a little.  She had made the choices she had made, and 
that was the end of it. There was nothing she could do to 
change things now. All she could do now was watch and wait. 

-- o -- o -- o --

Kat awoke in a hotel room not remembering how she got there. 
The clock on the table said 8:16am. She had slept almost ten 
hours! Matthew would be here in an hour or so. Cathline too. 
She needed them more now than ever before. In some ways it 
was easier when they were in danger. She knew they could help 
themselves. But this? She felt so helpless and shocked. How 
could Elizabeth be effectively dead? They had escaped from the 
Guild civil war, survived an explosion of a laboratory, being shot, 
having cancer and numerous other hardships, and now this. It 
didn't seem fair. Elizabeth had had her whole life in front of her. 
They had been planning the wedding only a few days before 
and now she would be thinking about funeral arrangements. 

Kat had to admit the doctor had a point. They couldn't keep 
Elizabeth on the machines forever. Sooner or later they would 
have to switch them off. She felt tears well up in her eyes again. 
Elizabeth was so young. Where had the time gone? It only 
seemed like yesterday that Elizabeth too her first steps, tottering 
along the furniture before launching out into the middle of the 
room.  She remembered Matthew playing chase with her, of 
them flying a kite for the first time. More tears flowed as she 
remembered Elizabeth at a precocious five telling the world she 
knew everything there was to know. Her teaching Elizabeth to 
swim in the pool, of making clay bugs on the table. The pride 
she had felt as a parent when Elizabeth had aced her exams 
allowing her to enter medical school, and more recently the 
sheer rightness of her engagement to Alex. That relationship so 
much reminded her of hers and Matthews, and now it had been 
cut tragically short. 

Alex walked into her room, carrying a tray with a pot of coffee and 
some croissants on it. "Hi Kat. I thought you might like some 
breakfast."

Seeing Alex brought fresh tears to her face. He looked older, 
more worn out than she had ever seen him. His normal fun 
loving self had gone, replaced by this husk of a man. "Thank 
you Alex." She said softly, taking the tray from him.

"I booked us into a hotel. You'd fallen asleep beside her when I 
awoke. I figured we needed our rest so I took us back here. 
Hope you don't mind," Alex said.

Kat put the tray to one side and gave Alex a deep embrace "Oh 
Alex, I'm so sorry," she cried.

Alex returned the hug and sat down, fresh tears in his eyes. 
"She looked so ill when I came. She looked dead already. I 
spent hours just holding her hands and talking to her. I prayed 
to any god that would listen that they would take me instead. I 
tried to make her better by force of will. I would take her place in 
a moment if I thought I could."

Kat gave a tearful nod. "I would too."

"But God or whoever didn't listen. They say she's already dead. 
How can that be, Kat? I love her. People say that love is the 
strongest force in the world, but that's not true is it? If it were, I 
could love her back to life, and then we could get on with our lives. I 
just wish it were me there, that's all."

Kat gave a sob. She had wished the same thing again and 
again. She wanted to say something, but couldn't find the right 
words. She held Alex's hand and embraced him once more. 

"Y'know Kat. They said they were going to ask you about 
keeping her alive, well, keeping the machines running that is. I 
need to know what you told them. Please Kat, I love her so 
much," Alex said tearfully.

"I told them to go to hell. But if the time comes, we'll make the 
decision together, you, Matthew and me. In the meantime, we 
spend every hour we can being with her, being there for her, 
and telling her how much we want her back." Kat tried to sound 
hopeful even if she didn't feel it herself.

"Come on, your coffee's getting cold. Let's watch some TV," Alex 
said handing Kat the tray.

"TV on," Kat said picking up a warm croissant and handing it to 
Alex. 

The picture on the wall faded from view and was replaced by a 
TV picture.

"DNA tests and brain scans have confirmed allegations that 
Elizabeth Stephens is not the real daughter of Matthew and 
Jane Stephens but is a direct clone of the late Dr Elizabeth 
Bexley. This dramatic new evidence came to light yesterday 
hours before Elizabeth Stephens was found gravely injured in a 
Yorkshire farmhouse. Her situation is described as beyond 
critical."

"TV OFF!" Kat screamed.

Alex was staring at Kat in hurt and pain. He put his croissant on 
the bed and stormed out. Kat held her head in her hands and 
sobbed. Surely things couldn't get any worse. 

-- o -- o -- o --

As Mathew walked from the taxi to the hotel reporters mobbed 
him. They huddled around him, trying to get that sound bite 
quote from him that would make the evening news. Questions 
were thrust at him from all directions

"What do you say about the new evidence that's come to light 
regarding your daughter?"

"What is Elizabeth's condition? Is she still alive?"

"Why didn't you tell the world this before?"

"What about the previous evidence indicating the opposite. Who 
fabricated that?"

"If Elizabeth recovers what does this mean for her and her 
fiancée? Does this mean she IS Dr Bexley or just shares her 
DNA?"

"Did you know the kidnapper? We understand she was 
Elizabeth's room mate -- can you confirm this?"

Matthew was about to answer 'No comment' but anger overtook 
him. "Look why don't you all just fuck off! My daughter is 
essentially dead, only the machines are keeping her alive, and 
all you wonder about is something as pointless as this. I've been 
on a fourteen hour flight, and I need to see my family, so fuck 
off," Matthew swore and stormed inside.

-- o -- o -- o --

Matthew put his finger on the biometric fingerprint reader on the 
hotel room door and opened the door. Kat was lying on the 
sofa gently crying. She heard him walk in and got up. On seeing 
Matthew she ran towards him and gave him a comforting 
embrace. "I'm so glad you're here," she cried.

"Me too. How is she? Have you heard? Somebody's leaked out 
all about Elizabeth. The press was swarming all over me 
outside. Where's Alex?"

"Elizabeth is the same as she was. I switched on the TV when 
Alex was here. We heard then. He glared at me and then 
stormed out. I've not seen him since," Kat said sadly.

"That's all we need. We'll leave Alex to Cathline. We have 
enough troubles of our own. She called me from her car. She'll 
be here in an hour or so." 

Kat snuggled up to Matthew "Last night was one of the worst of 
my life. The doctor wanted us to think about switching the 
machines off. They'll soon need the resources and space for 
people they can save." 

Tears formed in Matthew's eyes and he put his head on Kat's 
shoulder. "Meaning, there's no hope for her."

Kat snuggled in closer "There's always hope Matthew, there has 
to be."

-- o -- o -- o --

Anne pinned her new ID badge on her shirt and walked back 
into the hospital. She was wearing her new body, that of Dr 
Anne Williams, a divorced forty five year old with mousy brown 
hair and a normal looking but educated face. She was tempted 
to waltz in as the stunning new doctor, but she wanted to keep a 
low profile. Consulting the hospital layout on the wall she quickly 
found the secure unit where she knew Angela was about to 
moved from. It took her a few minutes to walk there along the 
long corridors, and eventually she turned into a side corridor and 
straight into two police officers. "Can we help you doctor?" they 
demanded.

In her best timid but dutiful voice Anne said, "I'm here to see 
Miss Holden. She due to go into custody later on today and I 
need to check if she is ok to travel."  

"Can I see your ID Doctor?" One of them asked.

"Sure," Anne said and held it out in front of her.

"Mind if we check it?"

"Fine," Anne hoped Heinlein's people had done their job 
properly.

A policeman scanned in the chip on the ID card with his PDA 
and in a few seconds he said, "Go on, You're cleared."

"Thanks, Officer," Anne smiled sweetly and went inside the 
room.

Angela was awake and reading 'Hello' magazine as Anne 
walked in. Thru her hospital nightgown Angela saw that her 
shoulder was bandaged tightly. 'Should I have hit your head 
instead?' she thought.

"Hello doctor," Angela said sweetly.

'It's hard to believe this is the woman, no, not a woman, the 
girl that did this to my Elizabeth' Anne thought. "How are you 
today?" Anne asked.

"I'm ok, but they think I shot Elizabeth, can you believe it? I'm 
her best friend! They kidnapped me too. It wasn't me! It was this 
vicious red headed woman. She shot me, and then shot 
Elizabeth. I gave the police a description of her."

Anne walked slowly towards the door and put a chair under the 
door handle. She then turned to a puzzled looking Angela and 
said, "Did she look like this?"

Anne felt her body morph into her 'Friday' guise and a few 
seconds later stood in front of a terrified Angela.

Angela's scream had died in her throat. It was the same woman 
as had paralyzed her last night! Furthermore this doctor had 
changed into her right in front of her eyes. But a full body 
change wasn't possible. All her life she had been told it hadn't 
happened, that DNA modification wasn't possible and therefore 
the events of the Fury were part of a ploy to destroy Dr Bexley. 
"Who... What..." She stammered.

Anne sat down on Angela's bed. "I think you know who I am.  I 
can only be one person can't I? Why'd you do it?"

"Beloved Mother," Anne whispered in awe. Surely Dr Bexley 
was dead. Every shred of evidence she had ever been shown 
said that she had committed suicide. If Dr Bexley were still alive 
then that changed everything. Why did she wait so long before 
revealing herself? So many questions formed in her mind.

"I never wanted to be turned into a goddess. Why did you 
kidnap Elizabeth and force her to become like me at the height 
of my madness? You made her into a monster!" Anne was 
trying to restrain her anger. 

"She wasn't a monster. She was you! We have liberated her 
mind from its shackles. Released her potential," Angela said as 
though repeating some mantra.

Anne took out the voice recorder from her coat pocket, and 
placed in on a tray in front of Angela. She pressed the play 
button and played her interview with Elizabeth the night before 
to Angela.

Angela's eyes widened with horror as seemingly Elizabeth 
explained the brutal fucking, murder and mutilation of her
family. "It's a lie. You recorded it!" she sobbed.

"It's no lie. Do you know who shot her? I had to shoot my own 
flesh and blood, and you made me do it," Anne's voice was a 
deathly whisper.

"How did we know she would turn out like this? She wouldn't 
come to us on her own. We needed to do something or else her 
gifts would be lost to the world," Angela said, trying to ignore the 
fact that it was her idol and her god sitting in front of her.

"Then that was her choice and you should have respected it! 
When you sit in your prison cell and rot for the next twenty years 
I want you to remember that you destroyed the life of my only 
child. I'll never forget or forgive that as long as I live!" Anne 
snapped. 

Angela stared at Anne, who thought she had betrayed the core of 
who she was and what she stood for. "You're not supposed to 
be like this! I love you, I love what you did, and what you stand 
for," Angela said, still deeply shocked by the venom of Anne's 
attack.

Anne continued. She wanted to take Angela down. Not kill her, 
but destroy this cult once and for all. "I've always been like this. 
As for what I did, I'm not proud of that at all. Yes, I saw your 
wrong and completely misleading propaganda about me, but I 
ignored it. It was amusing to see you people come up with even 
more improbable theories to explain what had gone on. The 
worrying thing was people believed you! Sure, it was nice for the 
ego to be treated as some kind of guru.  However, it misled a 
whole load of people. I haven't got any more answers than 
anyone else. Seeing you people do this to me made me sad 
and a little angry. You were defaming some of the most 
wonderful people I have ever known, and in case you're 
wondering who they are, they are called Matthew, Kat and 
Cathline. That's right. I feel honored and humbled that they 
forgave me and gave me a second chance. Not many people 
would. Are they the kind of people who would commit fraud and 
murder? I didn't think so."

"But you did so much good. You stopped a war, saved people's 
lives," Angela's previously haughty look had gone, and had 
been replaced by a look of hurt and pain.

"I also killed people. Everything Cathline wrote about me was 
true. I stopped a war because I had to, not because of some 
divine guidance. Actually, it took a whole load of us to do it. Kat 
deserves a lot of the credit and quite rightly she gets it; 
everyone involved does. None of what you gave me sole credit 
for I did alone. Curing Detective Cox, I had a whole team work 
on that for me. All I did was provide the plan."

Angela shook her head in disbelief, "No you're lying."

Anne gave Angela a vicious stare, "No I'm not! I've spent years 
trying to exorcise the ghosts of my past and everywhere I went 
you people were not only dragging them back up again but 
getting them wrong. Still live and let live, or so I thought; that 
was, until you took my daughter hostage. What you did to her I 
can never forgive. I vented all my initial fury on your cult leader, 
but when you come out from prison watch out! If you try to 
revive your evil cult then I will come for you. I will come for you 
all!" Anne's voice had dropped to a deathly hiss. She had 
suppressed the anger she had felt before, but this bitch in the 
hospital bed needed to be so scared and put in her place that 
she would regret her decisions for the rest of her life. Still in the 
same venomous tone of voice Anne said, "I'll say it again, just in 
case you missed it. You destroyed the life of my only child, 
someone who I had loved from the moment she was conceived. 
It was my love for her that kept me away, and my love for her 
that made me return to her when she needed me most. Yes, I 
shot her; I had to because otherwise that monster would have 
been loosed to the world. I may have pulled the trigger, but you 
have her blood on your hands. I want you to remember how 
much I hate you, how much I wish I had dissected you alive, just 
like I did the cult leader."

Angela gave a gasp of horror. Her father was dead! Killed by the 
woman she had adored.

Anne continued, "But I spared you. I've had enough of death 
and killing, and the thought of you rotting in a prison cell thinking 
on what you did to me is punishment enough. I hope it eats 
away at you day by day, minute by minute, until you feel so 
much grief that every day you struggle to find a reason to live. In 
my mind that's far worse than a simple bullet in the head and far 
more than you deserve."

Anne was about to launch another scathing attack, but suddenly 
noticed Angela reach inside her mouth and suddenly started to 
convulse. Her mouth was foaming and she was making gagging 
noises. Anne rushed over to her as various alarms went off 
around her. A few seconds later Angela had stopped breathing. 
Anne quickly changed back into Dr Anne William's body, stuffed 
the voice recorder back in her pocket and whipped away the 
chair from the door just in time before a full crash team burst in.

"I think she killed herself. Looks like a cyanide compound. There 
was nothing I could do," Anne said breathlessly.  

"What happened?"

"I was taking her new readings and just chatting. She then tells 
me she doesn't want to go to prison and then she reached into 
her mouth and suddenly convulsed there was nothing I could 
do. She was dead in seconds," Anne said sorrowfully. She 
hadn't meant to drive Angela to suicide with that last comment, 
but obviously being hated and despised by someone you had 
thought of as divine, added to the fear and humiliation of going 
to prison was too much for her. Anne knew the hospital board 
would interview her over this incident but she knew she could 
handle it. She felt sorry for Angela, believing that the woman 
who was Dr Elizabeth Bexley was some kind of prophet and 
source of all wisdom. Anne didn't feel like that at all.  She 
felt as though death, misery, and tragedy followed her wherever she 
went. Mark was right to walk away from her. She was right in 
her suicide note written years ago. She truly was death 
incarnate and Mark was better off well away from her.

-- o -- o -- o --

Kat, Matthew, and a newly arrived Cathline hoped they would 
find Alex at the hospital, but when they arrived at the IC ward he 
was nowhere to be found. The hospital staff had done a fine job 
of keeping the press away, so they entered the hospital 
unmolested. 

Kat had hoped that Elizabeth's condition would improve 
overnight, but a briefing from the doctor treating her told her 
otherwise. At least it hadn't gone downhill, was the most hopeful 
thing she could say.

"You know I'm here for you both," Cathline said, holding Kat's 
hand in comfort.

Matthew nodded, "Yeah, thanks Cathline. I just wish all this hell 
bitch's daughter thing hadn't come out. That's all we needed."

"Alex must feel as though we lied to him. It would look to him as 
though we didn't trust him enough to tell him. That's not true at 
all. It was between Elizabeth and him. It wasn't our business to 
tell him, it was Elizabeth's," Kat said, and glanced towards 
Elizabeth, still connecting to several machines and tubes. 

"I know," Alex said from the doorway. He had gone to the coffee 
machine and was now on his way back.

"Alex!" Cathline stood up and gave Alex a hug.

"Hey watch the coffee," Alex said, but returned the embrace all 
the same.

Standing up from his seat nearest Elizabeth, Matthew said to 
Alex, "Here have my seat."

"Thanks. Kat, I'm sorry for walking out like that. I was just in 
shock, that's all. Why didn't she tell me?" Alex said softly.

"I dunno. Maybe she thought it wasn't important. Maybe she 
thought who she was, was more important than where she 
came from," Kat said in reply. 

"I guess we'll never know," Alex said, and took hold of 
Elizabeth's hand. Turning to Elizabeth, Alex said, "Why didn't 
you tell me, silly! Did you think I would run just because of who 
your mother was?"

Elizabeth said nothing in reply. Just the constant breathing and 
beeping of the machines.

"We'll leave you to it," Matthew said. It was obvious Alex needed 
to get this out of his system.

A tearful Alex just nodded his thanks.

Kat, Matthew and Cathline filed out of the room leaving Alex 
alone.

"Hey Kiddo I brought you some stuffed toys down at the shop. 
They didn't have Kweepa and Rooney in stock yet, but I'll pick 
them up later for you," Alex fingered Elizabeth's engagement 
ring as if reminding her that she was still his.

"I don't know if you can feel this ring still on your finger, but it's a 
sign of our love for each other. It tells the world we are meant to 
be. I don't care whose cells you came from, or what DNA you 
have. I just want you back with me. Kat and Matthew showed 
me and you that love can cross any boundaries, outlast the 
fiercest fury and endure the greatest pain. If death is the final 
boundary then love can cross that too. No matter what happens 
I will love you until I finally join you at wherever we go when we 
die. I might look a little older than you, but you'll always look as 
you did that night on the beach, or when you put that ring on 
your finger," Alex wiped fresh tears from his eyes.

"I know that's what mom holds on to, John's memory that is. It's 
why she hasn't found anyone else and wont for the rest of life. 
Yes, I know she had a thing for Kat and Dr Bexley, but deep 
down she really loved John. I'm just like her; I mate for life. I 
know how lonely she is, and how it eats into her, but she's got 
me now, and that I think has almost made up for John not being 
there. If she can spend her life alone, waiting to be reunited with 
him then I can do the same. Elizabeth, I promise I WILL do the 
same. When it's time to say goodbye I will take this ring from 
your finger and wear it next to my heart, because that is where 
you will always be," Alex fingered the ring once more and 
clenched Elizabeth's hand tighter.

"We are soul mates, you and I. If our souls can't be together this 
time around, maybe they will another. Maybe this life was just 
them getting to know each other, and in the next life they'll meet 
and have real party. You've just got to the party before me, 
that's all. You can pour me a beer, get the best food from the 
table and wait for me. To me it will be a lifetime, but to you I'll 
just be a few moments behind."

Alex turned his head away and used his sleeve to brush away 
the tears. Turning once more to Elizabeth he said, "I don't want 
to wait until the next lifetime. I want you now! Prove me wrong 
Kiddo. Prove to me that you don't want to meet me there just 
yet. I dare you! You never could resist a dare from me could 
you? So why are you chickening out now!"

Alex looked up at Elizabeth's face hoping to see a flicker of life, 
but it remained still and deathly pale. Alex started to sob once 
more "Come on God, fucking do something!" he swore in 
desperation and despair.

There was no answer and Alex turned and kissed Elizabeth's 
hand once more. Any hope that he had been holding was slowly 
fading away. He realized that the sooner he faced up to 
Elizabeth's death, the sooner he could move on and start to 
rebuild. He glanced at Elizabeth's engagement ring. It would 
soon be next to his heart forever, and Elizabeth would be gone.

-- o -- o -- o --

"I don't understand it!" Mark was telling Wills.

"What's not to understand? She dumped her car at the golf 
course, left all her clothes behind in her room. There was milk in 
the fridge, food in the pantry, and a half drunk cup of coffee on 
the table. She's done a runner. Anne Baxter is no more, she's 
gone off to start a new life under a different identity," Wills 
explained.

"She told me she was working on something that would save 
the global, marine ecosystem. It seemed the most important 
thing in her life. We'd worked out we have less than sixty years 
before it faced total collapse. There's no way she would run out 
on that kind of problem," Mark said. Anne had seemed so 
fanatical and secretive about her project, abandoning it didn't 
seem to make sense.

"She can still carry it on elsewhere, under a different name." 
Wills suggested.

Mark rubbed his face in thought "But she left all her research 
behind. Her PDA, her E-library and her samples, everything. If it 
was that important and it was, she would take it with her. It 
would take years to get back to where she was now."

"I suppose. Did she send you any E-mail? A dear john?" Wills 
asked.

"No, nothing. She just told me she loved me and then after I told 
her how I felt she stormed off," Mark said.

"I just hope she's ok," Wills commented.

"Hah! 'Miss rip you limb from limb,' you can bet on it!" Mark 
snapped. The hurt of Anne's actions and revelation still ran 
surprisingly deep.

-- o -- o -- o --

The hospital board and the police were interviewing Anne. They 
were trying to find out if she had been involved in Angela's 
death, The interview had been going on for hours, and Anne 
desperately wanted to go and see how Elizabeth was doing.  
She had one final task to do before she left.

"Dr Williams, we've identified the cause of death."  

"Was it cyanide?" Anne asked.

"Yes. It was held in a small capsule contained inside the lower 
left molar. There were two small buttons embedded in the tooth, 
one either side so as to avoid accidentally setting it off. The area 
around the tooth hadn't healed properly so I guess it must have 
been put in recently."

"So I'm free to go?"

"One last question. Why do you think she waited until you were 
there to trigger it?" A policeman asked. 

"It's my guess she wanted a witness. To ensure the world knew 
about her suicide," Anne commented.

"Thank you Doctor Williams. It seems as though you did 
everything you could, and were just in the wrong place at the 
wrong time. We'll take care of everything from here on."

A few minutes later Anne walked out of the office. She made her 
way to the intensive care unit and found where Elizabeth was 
being treated. A young man she assumed was Cathline's 
son was sitting there holding Elizabeth's hand, and whispering 
into her ear. On hearing her walk in Alex looked 
up, his deep brown eyes streaked with tears, and his face 
utterly tired. Anne didn't want to shoo him away but he 
clearly needed a break. 

"I need to check on her condition. Would you mind leaving for a 
few minutes," Anne asked.

"Can't I stay? I promised her I'd always be here. What if she 
wakes up?" Alex asked.

"Then she'll still be here waiting for you," Anne said firmly.

"Doctor Atkins said I could stay," Alex protested.

Anne gave Alex a stern stare "Look, I admire your concern for 
her. If she were my daughter sitting there then I would want you 
to. But you look shattered, How much sleep have you had in the 
last day or so? You'll be no use to her or your family if you burn 
yourself out now."

"I suppose," Alex admitted. He stood up gave Elizabeth a 
goodbye kiss, and taking a last look back at her walked out of 
the room.

Anne checked over the readings on the life support systems. 
There had been no change at all in her external condition but it 
seemed as though the internal bleeding had been stopped fairly 
quickly. That was good. Elizabeth's patient log showed that a 
number of treatments had been discussed, including stem cell 
rejuvenation, but the consensus was Elizabeth was too far gone 
to respond. Anne had to concur with that prognosis. She looked 
at Elizabeth lying on the bed; what could be seen thru the tubes 
and breather mask showed that her face was peaceful and pain 
free. 

Anne walked to the door and flipped the sign across that said 
'Do not enter, treatment in progress', and closed it. That should 
keep Matthew, Kat and the others away for a while. She sat 
down on the seat where Alex had been sitting and took hold of 
Elizabeth's hand. "Elizabeth, I'm so sorry for putting you thru this 
but it was the only way. If I had let you go then somebody would 
have killed you there and then. That wouldn't have given anyone the 
chance to say goodbye properly, and not given me the chance 
to do what I have to do. Of all the things I have done in my life 
this was the one that broke my heart the most. I will look back 
fifty, a hundred years from now and know that I was the one 
who probably allowed my only child to die."

Anne paused for a few moments, gathering her thoughts. "I can't 
stay for long. I need to get back and get things moving on my 
project. If I fail then we'll all lose our children and their children's 
children. Elizabeth, I don't want to leave you but I have to. In all 
those years of watching you grow up from afar I never stopped 
loving you, never stopped wishing I could be there for you. And 
the one time I was there it was too late.  I'm in a dark pit and can see 
no glimpse of sunlight. The man I loved, who treated 
me like a real person, not some inhuman monster, has 
turned out like all the others. I want to go back and see if he'll 
try again. I don't blame him for the way he feels. It's not him, it's 
me. This quote sums up how I feel. I know you can't hear me 
but it does help me. 

'You do me wrong to take me o' the grave: Thou art a 
soul in bliss; but I am bound upon a wheel of fire, that 
mine own tears do scald like molten lead."

Anne looked at Elizabeth's engagement ring on her hand and 
smiled "It looks just like the one your dad gave me. I'm sure you 
were as happy as I was when you were asked. Our fates are 
linked, I think. We both need someone to pull us out of the dark 
places where we are," With her other hand she gently gave 
Elizabeth's hair a loving stroke, "I'm going to give you something 
to help you on your way. It'll take time to work but it's for the 
best."

Anne concentrated hard until sweat started to form on her brow. 
Inside her body she could feel her changeling organ starting to 
synthesize the chemical building blocks she required. She 
nearly passed out under the strain of concentration, but a few 
minutes later a small, needle like tube grew from her hand.
"I once gave Kat an old Egyptian blessing and it's stuck with me 
ever since. I'm now passing it onto you."

Anne took Elizabeth's hand once more and stretched out her 
lifeless arm. Tearfully she plunged the needle into Elizabeth's 
arm and whispered, "May God go with you in all the dark places 
where you must walk."

Within a few moments Elizabeth's already tenuous and weak 
brain activity had started to fall. Anne pulled the needle out from 
Elizabeth's arm, and it retracted back into her hand. She placed 
Elizabeth's limp arm back inside the bed and stood up. Putting a 
finger to her lips, and kissing it, she put it on Elizabeth's 
exposed forehead. Anne checked the monitor screens and 
already the brain activity was falling away. Anne looked around 
for a pen and paper and saw one on the clipboard at the end of 
Elizabeth's bed. She took it out and wrote down the same 
blessing as she had given Elizabeth, and signed it 'Dr Anne 
Williams'. 

Trying to resist a sob, Anne fled out of the room. 

-- o -- o -- o --

Kat's pager bleeped in the hotel room. She had been given it by 
the hospital in case of a change in Elizabeth's condition. She 
sprinted to it and saw a text message 'Please call - Urgent!'

"What is it?" Matthew asked.

"Quick pass me the phone," Kat demanded.

"Want me to wake Alex?" Cathline asked.

"No don't bother. He looks shattered. That doctor was right to 
send him home. We'll wake him if we need to," Kat said softly. 
This was hitting them all hard.

"Catch," Matthew said, throwing Kat the phone.

Kat quickly dialed the number and a few seconds later said "We 
need to go in. Cathline, leave a note for Alex. He'll want to 
come."

Within twenty minutes, they were inside another briefing room, 
much like the one Kat had been shown when she had first got 
there. Doctor Atkins and the neuro-consulant were present in 
the room, both looking gaunt and sad.

"What is it?" Kat asked hardly daring to speak.

"There's been a change in Elizabeth's condition, and it's not a 
good one. Over the last couple of hours her brain activity has 
dropped below what we would call the 'threshold of life'."

Cathline let out a cry of despair. She knew what it meant.

"What are we talking about?" Matthew asked.

The consultant replied, "The normal brain has millions of 
electrical pulses firing off every second. Elizabeth's has dropped 
to one or two per minute. It's just random neurons firing as her 
brain slowly dies. I'm so sorry, but her fight for life is over, from 
now on it's just the machines. She gave her consent for her 
organs to be used in the event of her death. Many more people 
will be able to live because of her."

"NOOO!" Kat roared.

Matthew just held his heads in his hands and sobbed. 

The neuro consultant handed Matthew a sheet of paper and a 
pen. Matthew took it, and said, "What's this?"

Doctor Atkins explained in a deeply sorrowful tone, "This is the 
form that gives us permission to switch the machines off. You 
can choose whatever date and time you want to make sure 
everyone is there who needs to be. It gives us permission to 
remove whatever organs we need as soon as you have said 
your goodbyes. The quicker we do this the more people will be 
able to live full and happy lives because of her."

"Don't you dare sign it!" Kat snarled at Matthew.

"Kat. Please let go of her. She's gone," Cathline said tearfully.

"I will not let go because she isn't dead!" Kat snapped. 

Matthew gave Kat a hug and said, "Kat, please let her go. I want 
her to be alive as much as you do.  But she's gone."

"You sign that form and the next form you'll be signing are our 
divorce papers!" Kat's face was red with a mixture of despair, 
sorrow and anger. From Kat's tone of voice Matthew knew this 
wasn't an idle threat. She really meant it!

"Mrs Stephens, other people need that equipment. We had to fly 
a small child who had been hit by a car, and was badly injured 
to another hospital today, because our intensive care units are 
full. If there were a glimmer of hope I would tell you. Please let 
your daughter go. There's nothing we can do for her now. For 
the sake of others, and yourself please let us do this." Doctor 
Atkins had seen resistance and denial like this countless times 
before. It was a natural reaction and it was best to let it burn 
itself out.

"I'll buy you a hundred fucking machines, I'll build an entire ward 
for you, just don't switch off those machines," Kat demanded.

"Kat, let her go," Cathline said softly.

"NO!"

"Please. For her sake and ours," Cathline said tearfully.

"NO!!" Kat's denial was more forceful than the last.

"How long can we wait before signing the forms?" Matthew 
asked doctor Atkins.

"We can keep her body functioning indefinitely, but we are 
beyond the point where it becomes of any use. Practically, we 
need those machines now."

"Not good enough!" Kat snapped.

"Kat, please," Cathline pleaded.

"No they can take me to court if they want, but I absolutely do 
not give my permission for this!" Kat said with all her will.

"Kat I've never known you so selfish. LET HER GO!" Matthew 
pleaded. 

"Selfish? Not killing our own daughter? I hardly call that selfish!" 
Kat shouted at Matthew.

"Kat she's already..." Matthew started to say. 

"Don't say it! If you finish that sentence than that's it between us. 
Forget thirty five years of being married and what we all went 
thru. If you make me do this then that's IT!" Kat's eyes were red 
with tears.

Matthew stayed silent. Kat was serious. There wasn't much that 
could drive her away from him but if he acted against her wishes 
in this then he would lose her and as well as Elizabeth. That 
was something he wasn't prepared to do. He had to give Kat 
time to overcome the shock she was feeling. Kat was in denial, 
he knew that, but she needed him more than ever and he 
needed her. There had to be another way. Then it came to him 
"It would take a few weeks to get a court order, correct?"

Dr Atkins nodded, "Yes it would."

Matthew turned to Kat and put his hand on hers "We'll give it six 
weeks. If anyone needs that equipment we will pay for them to 
use whatever facilities they need, Euro-health service or private, 
it doesn't matter. If you need more staff hire them, whatever it 
takes."

Kat nodded her agreement. "If there's no change in six weeks 
then I'll agree." As soon as she said it, she burst into tears, 
turned and gave Matthew a 'protect me' hug.  

Doctor Atkins said, "One more thing. The doctor who discovered 
her condition wrote you a message. I guess she knew what was 
going to happen, and sought to bring comfort to you. It's a single 
sentence and simply says 'May God go with you in all the dark 
places where you must walk.'"

Through her tears Kat gave a smile. "Tell her thanks. A friend 
told me the very same thing years ago. It stood me in good 
stead then and I'm sure it will now. Cathline, Matthew let's give 
Alex a call. He'll want to come."

-- o -- o -- o --

Anne packed her bag and checked out of the hotel. She had 
cried all the way home, but there had been no other choice. No 
choice what so ever.  On the way back she had made up her 
mind. She would go back to Mark. He was the only person she 
had left that she could go to. She needed to be near his 
innocence; it was the only way out of the darkness she was in. 
She had lived for years in the shadows of her mind and her past 
and now they had consumed her. Her final monologue with 
Elizabeth had shown her the way. If she continued the way she 
was, only death, despair and darkness would remain. She had 
just enough hope left inside her to believe that there was more 
to her fate than that cold, lifeless existence. 

Anne changed forms into Anne Baxter at Heathrow terminal six 
ladies room. Her thoughts went back to that hospital room 
where Elizabeth lay, back to a weeping Matthew, Kat and Alex, 
and how devastated they must be feeling.  Nothing she could 
think of could bring her any joy any more, her only thoughts 
were of the words from King Lear she had spoken to Elizabeth

"You do me wrong to take me o' the grave: Thou art a 
soul in bliss; but I am bound upon a wheel of fire, that 
mine own tears do scald like molten lead."

It would be a long flight and journey back to Haverford, so 
she tried to rest before the flight. At times like this she 
wished she still had use of the Aurora, but she wasn't sure she 
could face another gut wrenching journey.

Ten long hours later she paid the pound to release her car, gave 
a basic set of answers to the police, and drove back to her 
dorm. Mark had to take her back and this time she wouldn't take 
no for an answer.

-- o -- o -- o --

Mark was just in the middle of brushing his teeth when he 
heard a loud knock at the door. Quickly rinsing his mouth out 
and washing the spittle down the sink he ran to the door, "Ok 
Wills I'm coming he called."

Mark flung open the door and saw Anne standing in front of him. 
Mark thought she looked tired and worn out. Her normally 
flawless face had dark rings around her eyes, and her hair 
looked as though it could do with a wash. Anne was normally 
impeccably dressed, with every article of clothing carefully 
matched, but she looked as though she was wearing clothes a 
size too small that hadn't ever seen an iron.  It was the 
oldest and saddest Mark had ever seen her look. 

Anne spoke first; aware that she looked a mess "Can I come in. 
I need to talk."

Mark was about to tell her to go away, but the once infallible Dr 
Bexley, the woman who had changed the world forever, and 
had slain a gang who was going to kill them, now looked as 
vulnerable as a child. He wasn't sure if it was an act or not but 
he couldn't ignore her, not now. "Sure, come in."

Anne gave a smile. "Thanks," she said, and walked inside.

"Coffee?" Mark asked nervously. Why was she here?

Anne shook her head, "No thanks. I drank loads on the plane 
back so I only had a couple of hours sleep."

So she went overseas, Mark thought. Mark sat down on the 
opposite armchair to where Anne was sitting. "You look 
exhausted. Why not go back to bed."

"I needed to see you," Anne said softly.

"Why? I think we said all that we needed to say don't you?" 
Mark stated. A few days after she had left, the numbness that 
comes from a broken heart at started to set in. The last thing he 
wanted to do was reopen the wounds again.

"Please," Anne pleaded.

"Look. I've got a tutorial in about twenty minutes. What about 
after classes? That'll give you some time to freshen up and 
have a rest," Mark said. Why did Anne, sorry Dr Bexley look so 
mentally tired? It was as though all the life had been drained out 
of her and all that was left was an empty shell.

Anne nodded. It could wait till later "I'll meet you at the beach. 
Where we had our first date. At say six?"

Mark nodded his agreement. "Ok. It'll give me chance to collect 
all the stuff you leant me as well. It'll save you a job later on," In 
the meantime he would send a note to Wills asking him to 
explain the truth about Anne Baxter to the world if he didn't 
return and give a code word. He was going to take no chances 
at all.

-- o -- o -- o --

"So we have six weeks," Alex said tearfully. The rest of the 
family had driven back to the hotel to find Alex getting ready to 
leave for the hospital.

"That's all we could get. I'm sorry." Kat took hold of Alex's hand 
for comfort.

"So that's it. She's dead," Alex said bitterly.

Matthew nodded his head, "I'm afraid so. Any brain activity there 
is just the random firing of neurons as her brain slowly breaks 
down."

Cathline moved over and gave Alex a hug "We'll get thru this 
together just like we always have."

"It was only a week ago we were having punt races on the river 
Cam. I still can't believe she's dead," Alex wiped away some 
fresh tears.

"She not dead. I keep telling you. Why won't you believe me!" 
Kat snapped.

Matthew gave a sigh. "Kat I'm saying nothing. We said all there 
is to say back at the hospital.

"Good!" 

Cathline tried to defuse the situation. "Look, John's flying over 
tomorrow. We need to be there for him too. He's only just found 
out about the whole thing, so we all need to help him cope. 
We've had 48 hours to adjust to this. He's still trying understand 
how and why he's lost his sister."

"He hasn't lost his.." Kat started to say.

Alex reached over and took Kat's hand "Kat, you don't need to 
be strong for me. I know she's gone. If you don't let her go you'll 
only end up very ill and none of us need that. You need to start 
dealing with this properly, not deny it out of hand and get angry 
at anyone who disagrees with you."

On hearing this, grief welled up inside Kat and she let out a loud 
sob, "I'm sorry, maybe I am in denial, but part of me refuses to 
believe that she's dead. We have six weeks before they switch 
off the machines and I mean to make the most of them."

"Why did they do this to her?" Alex asked in disbelief

"Who. The Children of Bexley?" Matthew asked. He had been 
wondering the same thing.

"The police thought they might have tried to persuade her to join 
them. It doesn't matter now, does it," Cathline explained to John.

"I never had Angela down as the type. She seemed so nice. 
Elizabeth thought the world of her. She was going to be one of 
our bridesmaids." Alex turned and walked towards the hotel 
room window. Night had long fallen and the orange sodium glow 
of the streetlight's cast shimmering patterns on the roads. It had 
rained as they had come back from the hospital, which echoed 
the tears Alex felt form in his eyes. 

"Who knew? I heard she killed herself this morning. Couldn't 
face trial and the humiliation of the cult or so I heard. Why in hell 
did Elizabeth try and escape?" Matthew asked. Once again the 
empty, lost feeling he'd been having all day had nearly 
overwhelmed him.

"Because she takes after her mother," Kat said softly.

"She was her mother's daughter alright," Cathline agreed.

Matthew put his arm around Kat and drew her close. He ignored 
Kat's use of the present tense.  "We need an early night. We still 
have a long way to go, and this is only the second day."

-- o -- o -- o --

Anne sat herself down on the beach and proceeded to wait for 
Mark to arrive. She'd had a long relaxing bubble bath and had 
taken the time to do her hair properly. She found that she had 
been unable to sleep. Her mind was on Mark, and on Elizabeth so 
many miles away. His reaction earlier on in the day was a 
severe blow. He still wanted to break up, she just hoped he'd 
turn up. She checked her watch, it was now six thirty and Mark 
was half an hour late. With a sigh of resignation she stood up 
and walked towards her car. 

She reached her car and found a small parcel on the front seat. 
On it was a small note with a single word, 'Elizabeth' written on 
it. She recognized the handwriting. It belonged to Mark. Sadly 
she opened the driver's door and got inside. Reaching over, she 
picked up the letter and opened it.

"Dear Elizabeth"

Here are the things you lent me during our time together. I 
wanted to get them back to you as soon as I could. Please 
forgive my not turning up. I couldn't face seeing you again. The 
last few days have been the most painful of my life, but I realize 
that we are too different to be together. When I saw you 
standing outside my room today, part of me wanted you back 
but I knew then that we're not meant to be. 

I spent months wishing I could get to know you, but you're not 
the woman I fell in love with. She was just an act, a role for you 
to play. That's what hurts most of all, the woman I fell in love 
with wasn't real. She was a creation, made up by you. 

How can I forget who you are? How can we go back to how we 
were before? We can't. Too much has happened for that to be 
possible. 

I don't feel betrayed. You stayed when you could have 
just vanished into the night. What you told me the other night 
took real courage. 

I know you have a busy month or so. So do I. Whatever you are 
planning to do, I hope to God it works because we need it. I've 
mailed you my latest research, and I hope that it's of use to you. 
We both leave here in about eight weeks, and I expect we'll 
meet again at some conference. When we do, we'll be able to 
chat about all the fun we had and how things may have 
advanced. Please don't worry about me saying anything to 
anyone -- your secret is safe with me.

I'm not making myself too clear so please forgive me. I'm just 
trying to stop things before they got too far and hurt us more. 
I'm sure that there's someone out there for you. I'm just not sure 
that person is me.

Mark"

Anne tearfully put the note down. It was over. She had at most 
two painful months left before she finished here, but she 
decided that she would pack up and leave as soon as 
everything was ready. She was sure Tel-Aviv would take her 
back and the delay in the project wouldn't be that great. It would 
be fitting for Tel-Aviv, the site of her greatest failure, to be the 
place of her greatest triumph. She couldn't bear to be at the 
college campus any longer. Her pain was too great. Everywhere 
she walked she would remember being there with Mark, and of 
the last best hope he represented. She would pack only her 
notes, other essentials, and get the rest sent later on. She could 
be out of here in less than two hours.  

Her paper had a month of solid work left on it before it was 
ready. She would need to prepare samples, document 
everything she had ever done and ensure there was a complete 
and accurate audit trail of everything she had worked on. Her 
paper would face the full spotlight of a skeptical scientific 
community when it was published and she had to be ready for it. 
In a way it was just as well Mark hadn't shown, she wouldn't be 
able to pay him much attention anyway. But she had 
desperately hoped to be able to patch things up beforehand. 
Fresh tears formed in her eyes, born from a forever broken 
heart. She switched the engine on and drove off 

From Wills's car parked the other side of the road Mark and 
Wills watched Anne drive off.  Mark said nothing for a few 
moments, before turning to Wills and saying, "Come on we'd 
better go."

Wills turned to look at Mark. Mark's face looked deeply sad, 
there were deep worry lines around his eyes. He looked sadder 
than Wills had ever seen him. Even more so when he'd read 
about when Anne was missing after the boat accident. "We can 
still go after her," he said.

Mark shook his head, "No. It's for the best. We'd never catch her 
anyway. Why couldn't she be just a normal girl?"

Wills started the engine and slowly drew away from the side of 
the road "Because, she's not a normal girl. If she were you 
would never have noticed her. You spent months telling me how 
unique and special she was. What did you call her, that's right 
an 'Uber Babe'."

"That was before she turned out to be a inhuman killer," Mark 
snapped.

Wills indicated to turn left and joined the freeway once he was 
on it he turned and said to Mark, "From what I saw of her she 
was everything you described and more. You didn't fall in love 
with Anne Baxter you fell in love with her, Dr Elizabeth Bexley. 
I've just realized that you were very, very wrong about her," 
Wills wanted to have his say and switched off the auto-nav, the 
last thing he wanted was for it to keep interrupting him. What he 
had to say to Mark was important.

"How so?" Mark asked.

"She wasn't play acting, nobody is that good. That was how she 
really was. Anne Baxter wasn't just a name for Dr Bexley to hide 
under. It was how she really is. Don't you see she wasn't trying 
to hide? She was trying to rebuild her life. That's why she went 
back to college, built a whole life around Anne Baxter and 
eventually fell in love with a complete idiot called Mark."

"You heard the news the other day. The cops are going ape 
about it. They've issued an appeal for witnesses because they 
don't have any. I was going to call in. 'Yes Officer I know who 
ripped those men apart; it was my pissed off girlfriend'. You 
didn't see her rip those guys apart; it was horrific." Mark said 
bitterly.

Wills's sense of frustration was growing, "No I didn't. But you 
know what I'm glad she did it, because in that one incident she 
showed you how much she loved you. She put everything she 
had on the line for you that night. She risked everything she had 
done as Anne Baxter, her mysterious project, her entire life was 
laid bare for you. Sure, she could have just called the cops, run 
away, or even stunned those guys, but she didn't. In one 
moment she said 'Here's who I really am. I love and trust you 
enough not to hurt me or betray me'. That's hard enough for 
anyone to do let alone her."

"But she never said anything to m.." Mark started to say.

"Yes she did! She told you she loved you, and you've gone and 
thrown that right back at her."

"But.." Mark started to say

Wills interrupted again his voice  "For fucks sake, Mark! For 
nearly a year I've watched you mope around and wallow in self 
pity over that girl and not once told you to get a life. Now I am.  
You nearly failed your course because you were too distracted 
by her, and in fact she saved you didn't she? I've never seen 
you like this about anyone before. Not even me and we've been 
friends since the age of five! You don't feel like that about just 
anyone, Mark, and you don't throw it away because of what 
people did years ago. It's how they are now and what they are 
like now that matters. From what I've seen of Dr Bexley she is 
everything you yearned for, for months and more besides."

"But she kill...."

"Don't interrupt me! I've told you why I think she did what she 
did and from her actions after that I know I'm right. Deep down 
you do too. So do we go back to campus and you can live out 
your life wondering what if, or do we go find her and you can tell 
her what a full sized dickhead you've been."

Mark gave a deep sigh. Wills was right. He did still love her. 
Why else did he feel so sad and guilty about leaving the note? 
Why else had he stayed behind to watch Anne as she had 
picked it up and driven off? If he still didn't love her then why, 
back at his dorm this morning didn't he want to open the wounds 
again?  Why had he tried to talk himself out of being with her 
when all he'd done all year was yearn to be with her? The only 
answers to these questions were that he still loved her. He had 
always loved her and always would! "Let's go find her. I'll see 
what she has to say," Mark said softly.

Wills gave a smile "Even complete dickheads get it right 
sometimes."

Suddenly in front of them a concertina of brake lights flicked on 
from car to car. Wills swore quietly. He'd wanted him and Mark 
to have some peace and quiet, so he'd turned the auto-nav off 
and now he was caught in some kind of traffic jam. "Fuck it," 
Wills swore and switched the auto-nav back on

Straight away the dulcet female tones of the auto-nav said "Wills 
you have stationary traffic for six miles. A Tanker has overturned 
at intersection 15. The estimated delay is two hours. Would you 
like some music?"

"Fuck," Mark replied. Typical! He fished his PDA out and started 
to write Anne an E-mail. If he couldn't be there in person he'd 
send a letter.

-- o -- o -- o --

Anne had just finished packing the last of her clothes into her 
suitcase and was now composing a transfer request letter to 
send to the dean and Tel-Aviv. She'd managed to get a last 
minute platinum class flight to Tel-Aviv from JFK leaving the 
next day. She didn't want to spend that amount of money, but 
otherwise she'd be facing a three or four day delay for a 
standard seat.  She just needed to get away from this whole 
thing. She had debated flying back to England to see Elizabeth, 
but she knew there was nothing she could do for her now. Every 
visit she made to the hospital she risked being found out and 
that was too much of a risk for her to take right now. Besides, it 
was nearing the long summer vacation, soon the various 
experts she needed to court would be away from their research 
labs, and the whole process would slow down for another three 
months or so. She took a look around once more at the place 
she'd called home for two years. It hadn't been a bad place to 
live, certainly more comfortable than many other places she'd 
been. 

Her mind went back to her torture and killing of the cult leader. 
She'd felt justified at the time. The clock was ticking for 
Elizabeth and she had no time to waste.  In retrospect it seemed 
brutal and cruel, like something that that monster Deianeria 
would do. How much different had Deianeria's vivid description 
of the cruel sex, rape, killing and mutilation of her family been
compared to the death by vivisection she'd performed on the cult
leader? The stark truth was none at all. Although she could claim
the moral high ground by claiming it saved a life, in reality she
had done it out of anger, fury and fear for her daughter's life.
This time around she couldn't blame her MPD as she had been cured
for twenty years. Mark was right, she was inherently a merciless 
killer. Deianeria and her were one and the same. 

The thought disturbed her a great deal. Mark had been right not 
to show. How could he ever love someone like her? Not after all 
she'd done that was for certain. How would he react when she 
told him of her recent activities? Especially that she'd slowly and 
methodically dissected a living human being in order to get 
information.  She heard a bleep from her PDA, which was sitting 
on the bed and had been waiting to be put into her hand 
luggage. 

"Anne, You have one message from Mark Andrews," the female 
voice of the PDA called.

Anne thought for a moment. It didn't matter what Mark said or 
wrote. The fact was that she was just as much of a monster as 
she had been all those years ago. The motives might have 
changed, but the method and disregard for human life hadn't. 
Mark was worth more than she could give him. "PDA Delete and 
erase mail. Disregard all future mail from Mark Andrews."

It was so easy for her to say the words that would wipe away 
four months of hope for her but inside it was horrifically 
depressing. She had come back hoping to find a ray of hope for 
her but instead had only found the death of her dreams and the 
death of that hope. She placed the PDA inside her hand 
luggage and walked to her car. It would be a long drive but she 
knew she could keep going all night if she had to. Once she 
started work in Tel-Aviv then it would all work out, it had to 
because that was the only thing she had left!

-- o -- o -- o --

Wills and Mark cleared the traffic some ninety minutes later. 
Wills had parked his car as close to Anne's dorm as he could, 
but had noticed that Anne's car had gone. Mark had said that it 
didn't mean anything. Maybe she'd had to park it at a more 
distant lot and walked the rest of the way. Wills however wasn't 
so sure. As soon as Wills's car had drawn to a stop Mark 
pushed open the door and sprinted to Anne's dorm. A few 
seconds later Wills was in hot pursuit. Not wanting to wait for the 
elevator, Mark ran up the five flights of stairs and almost skidded 
to a halt outside of Anne's door. "Anne, Hey open up." Mark 
gasped.

There was no answer.

"Hey Anne. Open up we need to talk," Mark shouted thru the 
keyhole. Mark peered inside the room. It was dimly lit inside and 
that didn't hold out much hope that Anne was inside. 

"Anne. Come on please," Mark pleaded.

Mark heard some footsteps behind him and whirled around, 
hoping it was Anne, but to his dismay it was only Wills emerging 
from the elevator.

"Not there huh?" Wills asked.

Mark gave a sigh, "Doesn't look like it!" Until this point he'd been 
full of hope that he could patch things up with Anne, but now 
she'd gone.

Wills tried to cheer Mark up. "Let's try the lab. Maybe she's 
there?"

Mark smiled, "Oh course! Let's go!"

This time both of them took the elevator and sprinted across the 
lawn towards the science faculty. They arrived there a few 
minutes later, and found the doors locked and the lights off. At 
the sight of this Mark shook his head in defeat and sat down on 
the steps leading up the to building. He was too late.

Wills gave Mark a comforting look, "Look she's probably just 
gone off to think. We'll try again in the morning."

Mark felt relieved "Ok."

-- o -- o -- o --

The next day Mark and Wills tried Anne's dorm once more. 
Much to Mark's dismay there was still no answer to his repeated 
callings. A quick trip to the science faculty proved fruitless, as 
did a search of all the college's allocated car lots. In desperation 
Mark sent an email to Anne's faculty head asking for information 
on her. The police weren't interested until twenty four hours 
were up so it came down to Wills and Mark to find out where 
she had gone to. So they sat outside the science faculty 
wondering what to do next. 

"I know where she's gone," Wills said, looking at the screen of 
his PDA.

"Where?" Mark asked expectantly.

Wills pointed at the screen of his PDA. "She's gone to be with 
her daughter."

"Daughter?" Mark was stunned. Since when had Dr Bexley ever 
had a daughter?

"Oh Mark! We can get up-to-the-second information, and net 
access points are everywhere we go, and you seem to move 
around in blissful ignorance. It turns out that Elizabeth Stephens 
is really Dr Bexley's daughter. She cloned herself years ago and 
impregnated Jane Stephens with the embryo or something. 
Anyway Elizabeth Stephens was kidnapped a few days ago and 
was killed while trying to escape. Well just about killed, she's in 
a coma and only bio-support is keeping her alive," Wills 
explained. Sometimes he wondered what planet Mark lived on.

"Fucking hell. Poor Anne. No wonder she looked beat when I 
saw her. I bet that's where she went for those few days. She 
came back to see if I would have her back and then when I 
wouldn't she's gone back to be with her daughter again," Mark's 
stomach felt sick. The fact that his girlfriend had a daughter the 
same age as him was hard enough to take in, but in Anne's time 
of greatest need he had thrown it back in her face. But how was 
he supposed to know? He just wanted to be with her again, to 
help her come to terms with the death of her daughter, and to try 
and put their lives back on track. From what Wills had just read 
Anne really would need all the help she could get. Help that he 
had thrown back at her.

"How do you feel?" Wills asked.

Mark sighed, "Like I've kicked her in the teeth. She came back 
for me to help her and I kicked it right back at her. Why do I 
always screw up when it comes to her? I checked my mail this 
morning. She deleted my mail without even opening it. I sent 
another but it came back as blocked. I don't blame her for doing 
it. I hurt her more than I thought. What am I going to do Wills?"

"We're going to find her and you are going to work this out," 
Wills said determinedly. 

"I guess. Look why don't we go see the faculty head in person. 
Maybe he knows something by now," Mark said. His sprits had 
risen a little by Will's pep talk.

A bleep came from Mark's PDA and he quickly took it out of his 
pocket. "It's from the faculty head. That was quick."

"What's it say?" Wills said excitedly. 

Mark read it out "To Mark Andrews, from Blah blah. Here we go. 
Elizabeth Anne Baxter has requested a transfer to Tel-Aviv. 
Please forward your important family news to 
services@telaviv.edu."

"She's gone to Tel-Aviv?" Wills asked.

"I guess she wanted to finish her work away from me," Mark 
said glumly.

"At least you know where she is. All you need to do is book 
yourself on a flight and go meet her!" Wills stated.

Mark's spirits rose. Still holding his PDA he said "PDA what's 
the next available flight to Tel-Aviv?"

There was a few moments silence and then a silky female voice 
said, "The next flight with available seats is four days from now."

"Four days! PDA, what about standby seats. How much are we 
talking about?"

A few more moments of silence as Mark's PDA interrogated the 
airlines booking systems "Standby seats with only a 20% 
chance of departure are available two days from now at a price 
of two thousand dollars! Standard price seats flying economy 
class are available at four thousand dollars. There is a ten 
percent deposit for all seat reservations"

Mark shook his head in disappointment "Well that's it then! It 
may as well be four million dollars! I can't afford four hundred let 
alone four thousand! I know Mom and Dad can't either. Where in 
hell am I going to get that kind of money?"

"From me," Wills said quietly.

"You haven't got that kind of money either!" Mark complained.

"Yes, I have if I sell my car. I should get 6K for it. That's enough 
to send you to her and enough for me to get another car."

"Wills, I can't ask you..." Mark started to say. 

Wills gave Mark's shoulder a friendly pat, "You don't have to ask 
me. Look, we've been friends for nearly twenty years. If Anne is 
anything like the woman I know she is, she's worth every cent."

"Will's I don't know what to say," Mark said. He was nearly 
moved to tears by Wills generosity.

Wills smiled "You can tell Anne you love her. That's enough for 
me. Go ahead, make the reservation. It'll take me a few days to 
sell the car. Anne will still be settling in, so you've got a good 
chance of meeting her there. What's your credit limit at the 
moment?"

Mark shrugged. He hadn't a clue, "PDA what's my current credit 
limit?"

The PDA replied a few seconds later "Your credit limit is four 
hundred and twenty dollars"

Mark smiled "PDA reserve me one open ended return to Tel-
Aviv. Standard class leaving five days from now. Use Visa card 
1 for reservation deposit"

The PDA beeped for a moment. It would take a few minutes to 
check all the details.

"There we go. Sorted!" Wills smiled.

"YES!" Mark punched the air with a clenched fist.

The celebrations were cut short by Mark's PDA "I'm sorry. 
Travel visa to Israel denied!"

"PDA, Why in hell. I've got a valid visa for all travel," Mark 
complained

The PDA continued "Visa denied because of previous visit to 
Egypt less than one year ago. A new Visa will need to be 
obtained alongside appropriate security clearances."

"Fucking field trip!" Mark swore. He'd been denied because of 
the field trip to Egypt some months before!

"PDA how long to obtain a new visa?" Mark asked. His heart 
was in his mouth. It could be months if at all.

The PDA was silent for a few minutes until it spoke once more 
"Israeli immigration database indicates that the lead time is a 
maximum of eight weeks. "

"Eight Weeks! She'll be long gone by then!" Mark complained. 
His dreams of getting back with Anne were slipping away. 

"First things first. Apply for the visa, let me sell my car and the 
rest is down to fate," Wills said in a matter of fact manner. It was 
going to be a long two months for the both of them.

"At least it'll give me chance to finish my dissertation before I go. 
I might even stand a chance of getting a Ph.D. by then," Mark 
tried to look on the bright side of things. It worked, but only up to 
a point.

Wills gave Mark wry smile, "Come on old friend. I'd better enjoy 
my car while I've still got it. "

-- o -- o -- o --

It had been one of the longest weeks Kat had ever endured. 
John had arrived a few days ago and had immediately broken 
down in tears. It had fallen to Kat to try and comfort him as only 
a mother can, but in the end she felt as sad as he did. Elizabeth 
had shown no improvement at all, and although they hadn't said 
anything she knew the doctors desperately needed the 
equipment. In her heart, she knew that there was still some 
hope for Elizabeth. There had to be, because the alternative 
was too awful to contemplate. 

She had calmed down from her initial reaction. The shock had 
given way to stoic determination. For his part Matthew was 
standing by her, comforting where she needed it, supporting in 
the quiet times and a shoulder to cry on for the rest of the times.  
Cathline was trying her hardest to comfort Alex who had nearly 
burnt himself out with his constant vigils. In the end they had 
settled on a six hour rota, so that Elizabeth would always have 
those she loved around her. Alex had been able to get some 
welcome rest, and now as Kat walked in to take over from 
Cathline it she thought about what she would say to Elizabeth. 
They had made a policy decision not to speak about the 
sadness they felt, only about the good times they had shared 
together.

As Kat walked into the IC room, she saw Cathline still holding 
Elizabeth's hand. On hearing Kat walk in Cathline looked up, her 
one good eye streaked with tears. Cathline shook her head as if 
to say 'no change'. For her part Kat just nodded sadly and 
swapped seats with Cathline. Normally Cathline looked radiant, 
improbably beautiful but the strain was showing on her face. 
Cathline gave Kat a comforting pat on the shoulder and left, she 
was too tired to speak.

Kat took hold of Elizabeth's hand and started to speak.

"I Remember when I first found out you were inside me. It was 
quite a shock I can tell you, but seconds after I was told I knew I 
had to keep you. How could I kill a new life that was growing 
inside me, even if you weren't mine? As you grew so did my 
love for you. I remember running to Matthew after I'd felt your 
first kick, and demanding he feel it too. We used to talk to you 
every night when you were inside me. Telling you what a special 
girl you were going to be."

Kat paused for a few moments, remembering the feelings of 
motherhood. Gathering her thoughts she continued, "I'll admit 
you didn't come easy into the world. We thought we'd lost you 
for one moment but you fought back and lived. You're like your 
mother that way, a survivor."

Thoughts of those panicked few seconds, when a newly born 
Elizabeth had stopped breathing, came back to Kat. Much to 
Matthew and Kat's relief Elizabeth had decided to start 
breathing again, and the emergency had passed. Kat resumed 
"It was hard at first being a parent. Still, with each passing day 
our love for you grew and grew. Matthew was there to see your 
first smile, the first time you rolled over and your first steps. He's 
very proud of you. Sure, as a toddler you had an awful temper 
on you, but you always seemed to know how far to push us. We 
all had a hard time when you started school. You being the 
daughter of such famous parents and us saying goodbye to you 
every day. We knew you were special when you started to ace 
every test you were given. It wasn't until we had the blood and 
brain tests done did we know how special you are."

She remembered the look of horror on Matthew's face as they 
were told the news. She felt the same, but deep down her love 
for Elizabeth stood firm. That day she had vowed to treat 
Elizabeth as her own flesh and blood daughter and not make 
the mistakes Dr Bexley's parents had. They had been 
outraged when they were told in no uncertain terms that 
Elizabeth would be confined for her own safety and that of 
others, should she exhibit the same behavior as Dr Bexley. 
In the end they had reached a compromise. Cathline would act 
as the counterbalance, and would decide if and when to notify 
the authorities. From that time on Cathline had been nearly as 
involved in Elizabeth's upbringing as Matthew and herself. Kat 
continued to speak to the lifeless Elizabeth, "It's not the major 
things I miss. It's the thousand little things, like the way you and 
Alex used to feud. Each of you trying to out maneuver the other. 
Like when you decided to go brunette for a week, those kind of 
things. They add up to an experience that I would never give up 
for anything in the world. I always wanted to be a mom and you 
know what? It's more than lived up to my dreams. You have 
more than lived up to my dreams and expectations," Kat gave 
Elizabeth's hand a squeeze. She checked her watch, only five 
hours and fifty minutes to go. Her optimism at the start of the 
week was starting to fade, but from being Elizabeth's mom for 
the past twenty two years she knew one thing. Elizabeth 
wouldn't give in without a fight, but she had to admit this might 
be one fight she couldn't win. 

-- o -- o -- o --

If the first week was hard on Kat then the next month was even 
worse. The daily vigils had continued to no discernable effect on 
Elizabeth, and now even the stoic Kat was starting to think it 
was all over. They now had only four days left before the 
machines were switched off and it was a deadline that prayed 
on all their minds. In fact if that day's readings on the bio-
support systems were to be believed, then Elizabeth's body was 
in the process of dying, in spite of the machines. The effort the 
bio-support systems took to keep her alive had increased by 
some 17% over the last few hours, and the doctors had told 
them it was a sign that the end was close at hand. Kat had 
allowed Matthew to start making the funeral arrangements. 
Elizabeth would be buried in the tomb where Salah had been 
laid to rest. Her friends from Cambridge had already been 
notified of the date and arrangements made to fly them to the 
island where Elizabeth would be buried. 

Matthew had set the date for two weeks from now, which would 
give them enough time to bring Elizabeth's body back, and 
prepare it for burial.  Alex had asked them if he could keep the 
engagement ring he'd given her, and of course they had agreed. 
Elizabeth would be buried in her favorite outfit, the one she had 
bought for the meal at the London Hilton. From all around the 
world messages and get well cards had been pouring in to the 
hospital. It was good to see that so many people cared about 
them. Flowers had been arriving every day from people they 
had never met. So many in fact, that Kat had, had to employ 
some few administrators to note down the names of the well 
wishers. Kat vowed to write to everyone in person to thank them 
personally. It meant more to her than she could say. 

Matthew and her had been asked for several interviews for the 
TV and webcasts, but had politely declined. This was a private 
moment and they didn't want to share it. They would issue a 
press statement in a few days time to thank all those who had 
offered support and to congratulate the medical team there. 
Kat's hope had all but faded, but she had just enough 
determination to refuse to have the machine's switched off early. 
They had gone this far, so another four days wouldn't matter. 
Matthew and she had scheduled Elizabeth's time of death to 
be at 13:18. This was the time she was born, and it gave a 
certain sense symmetry to her life. 

Kat had been impressed with Alex. He had stood beside 
Elizabeth every hour he could get away with, and had been on 
hand to provide advice and comfort to them all. He was so like 
Cathline it was unreal. She was glad he was there. In the last 
few months he had changed from the immature joker to a 
mature young man. He and Elizabeth would have been so 
perfect together. When she had seen them together it was just 
like she and Matthew had been. But now the dream was over, 
shattered by a single gunshot from a fanatical organization.

Nobody had seen the Children of Bexley cult leader for weeks 
and it was thought he was on the run. The cult had denied all 
knowledge of the kidnap, but it's records and assets had been 
impounded on both sides of the Atlantic. She'd had a strange 
message from the Guild stating that Salah's body had been 
exhumed and was undergoing tests. Kat had no idea where that 
had come from, only that Elizabeth had requested it be 
performed a few months back. Kat guessed it was part of 
Elizabeth's project she had been running after her first 
semester. The message had also implied that the Guild knew 
what to do with the information, so Kat just let it go. The Bexley 
cult had been the bane of their lives for years and now it 
seemed as though they had taken their adoration too far. She 
was sure it wasn't the whole cult, only a few crackpots but that 
was all it took to end her daughter's life.

At least it looked as though the Bexley cult was finished. After 
they had fucked up the kidnap, people were apparently leaving 
in droves, disillusioned with the whole thing. Kat was pleased, 
but that didn't bring Elizabeth back. Matthew and Cathline 
shared Kat's feelings on this, but Alex was finding it hard to 
understand why they would do anything like this. Sure he 
understood in his head, but his heart was still some way behind. 
John too, was finding it hard to come to terms with the death of 
his sister, but he had tried to busy himself in the detail of the 
funeral arrangements. Kat kept a watchful eye on him in this, 
making sure he didn't bottle up how he really felt. John was a lot 
like Matthew in that respect. Matthew would bottle things up until 
he snapped and John would have done the same. 

Elizabeth's burial clothes would be here tomorrow and Kat and 
the others still had a lot to do. 

-- o -- o -- o --

Wills ran up the stairs to Mark's dorm. With a loud staccato 
knock he banged on the door. It took Mark a few minutes to 
answer "Hey Wills wass up?"

Wills smiled, "I've just transferred four thousand dollars into your 
account. I did a great deal on the car, so I've got a bit more than 
I wanted but all the better."

Mark punched the air "Wills I could kiss you."

"People will talk, and besides, what would Anne say?" Wills 
smiled.

Mark laughed. "Guess what? My visa's due next week so I can 
go ahead and book."

Wills walked inside Mark's dorm and sat down. "Any news from 
Anne?"

Mark shook his head, "Nope. I know she's arrived and the 
transfer's been agreed, but she's still blocking my mails. All her 
samples went over last week, so I guess she's still working on 
whatever she's working on. I've tried calling the university but 
they won't give out personal details over the phone. I've waited 
this long I guess it won't matter if I wait a little longer."

-- o -- o -- o --

Anne checked the clock on the wall. She had been working a 
solid fifteen hours today, and she was starting to feel tired. Her 
PDA had told her that Mark had tried to mail her every day for 
the past five weeks, and that the PDA had blocked and deleted 
every single one.  She had managed to hide her pain in her 
work and had fallen back on her old escape route of pushing her 
mind and body to the very limits. She was so close to finishing. 
She just had to validate the effects on the food chain and she 
would be done. There would be plenty of time for rebuilding 
afterwards. 

She had noted with dismay that Elizabeth's bio support systems 
were due to be switched off in two days time, and that thought 
did nothing to ease her depression. She had kept a happy face 
on for her colleagues but it was so hard to keep up the facade. It 
was now too late to do anything about Elizabeth.  But did Mark 
want a reconciliation? The Mark situation she could do 
something about if she wished but did she want to? She'd had a 
month to debate her choice to leave him behind, and now in the 
cold light of day it she saw it to be the correct one. 

She had shown no mercy to the cult leader and the gang 
members. Mark was right. It was in her nature to be utterly 
ruthless. Mark needed someone who was compassionate and 
caring. Someone who he could love as much as they loved him. 
As much as it hurt Anne to admit she wasn't that person. Sure 
she cared deeply about the people she loved, but there was a 
ruthless and vicious side of her that she hated and knew Mark 
did too. Whatever he might feel at the moment she knew that 
when he found out about her activities then the whole thing 
would blow up again. For a while she had considered not telling 
him, but a relationship with secrets was no relationship at all. 
The gene sequencer telling her that the sample had been 
successfully analyzed distracted her thoughts. 'No rest for the 
wicked' Anne thought as she studied the print out from the 
sequencer. She did however allow herself a smile at the results. 
The evidence that she was right was now irrefutable. 

-- o -- o -- o --

For the next two days Kat, Matthew, Alex, Cathline and John 
hoped and prayed as they had never done before. The only 
response was another 10% increase in the amount of work the 
bio support systems had to do just to keep Elizabeth's body 
alive. For Kat this was the final confirmation that she had been 
wrong and it hit her hardest of all. Her daughter was dead in all 
but a signature on a page. Now came the hardest day of all. 
Kat had finished dressing in a dark black dress, and had tied her 
long black hair up into a bun. Matthew, John and Alex were 
dressed in black suits and dark ties and Cathline too was 
wearing a newly purchased long flowing black dress. 
All five of them got into a limousine to take them from the hotel 
to the hospital.   On Matthew's request the media had stayed 
away, a gesture for which Kat was grateful. This was a private 
moment, a moment when they would flip the switch to end their 
daughters life.

Inside the limousine Kat allowed herself to cry and was 
immediately comforted by Matthew and Alex. "When the time 
comes. I want to do it. I was the one who bought her into the 
world so it's fitting I should be the one to take her out of it," Kat 
said, choking.

"Ok," Matthew agreed. In a way he was glad Kat wanted to 
switch the machines off. It was not a task he had been looking 
forward to, and besides, Kat had lived these last few weeks in 
denial and this would help her.

"Should we have gone for two more weeks?" Kat sobbed into 
Matthew's arms.

Gathering all his courage Matthew drew Kat closer into his 
shoulder and stroked her hair. "Kat, my love. You'll always want 
two more weeks. We have to let her go," Tears formed in 
Matthew's eyes. That was the hardest thing he'd ever have to 
say. He so wanted those extra weeks of slender hope, he would 
trade his life for those weeks but he knew that it was time to let 
go or he might never.

"I know," Kat said, and broke into deep gasping sobs of 
tears.

"Mom, We're here for you. For each of us," John said softly. He 
hated to see his mother this way.

They sat in silence for the rest of the journey. Each of them 
wrapped up in their own thoughts and memories. Dr Atkins and 
Dr Roberts, the neuro-consultant met them at the door of the IC 
ward and they were then escorted to a side briefing room.

"We've got the papers for you to sign," Dr Atkins said softly. 
Inside his heart was breaking as well. This remarkable family 
had stuck together for the past six weeks, and now it was time 
for their greatest trial of all. Dr Atkins put two copies of the forms 
on the table and continued to say, "As Elizabeth's parents you 
both have to sign a copy of the forms. I then need to 
countersign them as Elizabeth's doctor and then both of them 
need to be witnessed by Cathline and Dr Roberts. 

Sniffing back tears Matthew said, "Thanks," and took the forms 
from the table. He gave one copy to Kat and kept one for 
himself. Matthew read the form carefully and flipped the page 
over and then re-read it once more. He tried to keep calm and 
composed, but before he could sign a deep sob came from his 
throat and he had to force it back down again. He took a deep 
breath, and signed and dated the form.

For her part Kat had read the form twice as well, studying every 
single line of text. She glanced in Matthew's direction and taking 
a deep breath, as if steeling herself against a great trial, and 
signed her copy of the form. As soon as she had done that she 
broke down into an inconsolable mass of tears and sobs. 

Matthew immediately moved over to comfort Kat, his face full of 
tears. Cathline walked over and placed a hand on Kat's 
shoulder. She bent down and whispered in Kat's ear "Kat, it's 
time."

Matthew handed the forms back to Dr Atkins for counter 
signatures and then had to help Kat to her feet and clutching 
onto Matthew she walked into the room where Elizabeth lay. 
One by one Cathline, Alex and John filtered in and stood around 
the bed. Matthew took hold of Elizabeth's hand and held it to his 
chest. Alex took hold of her other hand and kissed it gently. 

"Here is the master switch," Dr Atkins said pointing to a large 
red switch on the side of one of the machines.  

Kat nodded and moved over towards it.

Dr Atkins pointed to another row of switches each colored a red 
color "First, you flip these three switches in the order up, down, 
up. Count to ten and then flip them down, up, down. You then 
have 30 seconds to flip the main switch before it resets again."

Kat turned to Matthew and cried "Mat, I can't do this. I thought I 
could but how can I?"

Matthew nodded in sympathy. He felt exactly the same, but it 
had to be done. "Kat. I'll do it. She'd want one of us to rather than a 
doctor."

Kat tearfully agreed but then changed her mind "We'll both do it. 
You do the three and I'll do the last one."

Matthew sighed. "Ok what's the time?"

Dr Atkins checked his watch "It's 13:17".

Matthew slowly walked up to the bio support system and 
breathed in. He moved the switches up, down and then up and 
counted to ten. He was grateful for the gap, as it allowed him 
time to compose himself. Finally he reversed the order and a 
voice said "Warning. Shutdown protocols activated."

Matthew moved back to the bed, took hold of Elizabeth hand 
and held it tight once more.

Her hand shaking, as if she was pushing against an invisible 
wall, Kat's finger rested on the master switch. Images of her 
giving birth to Elizabeth, of Elizabeth starting to walk and talk 
and then telling her of her engagement to Alex flashed thru Kat's 
mind. She nearly pulled back but digging deep into her last 
reserves of courage she flipped the master switch down.

There were ten warning bleeps and within a matter of moments 
all the monitors went flatline. Elizabeth's chest stopped rising 
and falling and a sense of calm descended on the room. Kat 
screamed in despair and sadness. At the same time Cathline, 
Alex and John cried deep, gasping sobs

Matthew clutched hold of Elizabeth's hand even tighter, bent 
down and kissed Elizabeth's face and whispered "Goodbye little 
mite," and gently put Elizabeth's arm back down on the bed. He 
then joined Kat in weeping for his daughter. 

A few minutes later; after waiting for the initial tide of grief to end 
Dr Atkins asked "If you'll just sign here Mr Stephens. This is the 
formal death certificate. If you don't mind we'll need to take the 
body now for organ harvesting. Elizabeth has saved many lives, 
it's what she would have wanted."

Kat was still in shock and weeping "I killed her!" over and over 
again. John and Cathline were attending to Kat and Alex just 
stood over Elizabeth's body in shock. He pressed his finger to 
his lips and put it on Elizabeth's head. He took a deep breath 
and whispered "Bye Kiddo. Wait for me won't you?" He bent 
down and gently kissed Elizabeth's exposed forehead. He then 
put his mouth to her ear and whispered, "All of my heart, 
forever."

Matthew surveyed the aftermath around him and took the form, 
signed it and gave it back to Dr Atkins. 

"You mind if I stay with her?" Kat asked.

"We're only taking her down the corridor. You'll see her again 
soon," Doctor Atkins said softly.

"I just want one more look at her," Kat sobbed.

Matthew took hold of Kat's arm in comfort. "Kat, my love, you'll 
always want one more look. Let her go."

Deep down Kat knew Matthew was right, Elizabeth was gone.

-- o -- o -- o --

In her dorm in Tel-Aviv Anne checked her watch as the time 
flipped over to 16:18. From the news reports she had read 
Matthew and Kat had just switched off Elizabeth's life support. 
She so desperately wanted to be there. but knew that she would 
give herself away by the emotion she would be unable to 
contain within herself.

She had wished a lot of things on Matthew and Kat over the 
years but not what they had just been thru. That thought gave 
her a glimmer of hope. Deianeria had shown no remorse at what 
she had fantasized about raping and murdering her own family, 
whereas she at the height of her fury had fallen short of that 
horrific act. Deianeria took sexual pleasure from killing whereas 
she had only killed when needed. It was a fine line but one that 
gave her a slender thread of comfort.

Anne tried to get back to some work but her thoughts kept 
wandering to the IC ward in that English hospital.  She knew 
what was going on but she so wanted to be there it hurt. To try 
and take her mind of events, she turned back to her PDA and 
started the final read thru of her paper.

-- o -- o -- o --

Mark's PDA bleeped a few times, which had the effect of waking 
him up from his sleep. Wearily he got out of bed and walked to 
the table where the PDA was still beeping away. "What now," he 
muttered.

"PDA read mail message to me please," Mark said sleepily. It 
was too late now. He was up and awake, and no amount of 
counting sheep would rectify that. This had better be good.

The PDA read. "To Mark.Andrews@Haverford.edu. From 
immigration@israel.nation
Dear Mr Andrews. You request for a travel visa has been 
approved. Please note that future travel to restricted countries 
may revoke this Visa or lead to deportation from Israel. We hope 
you will enjoy your stay."

Mark shouted, "YES!" He was now only a few days away from 
meeting Anne again. He just hoped she'd still be there when he 
arrived. His first reaction was to call Wills and tell him but then 
he remembered that it was still first thing in the morning. Instead he 
readied himself by sending his newly acquired visa number to 
the airline to finally confirm his place on the flight. It would take a 
while to get confirmation thru so in the meantime he walked into 
his kitchen, hunted around for a clean cup, and started to make 
himself a cup of strong coffee. 

-- o -- o -- o --

Hand in hand Matthew and Kat walked down the long corridor of 
St Luke's hospital as they had done every day for the past six 
weeks. Every step was an effort, but in a way they both felt relief 
from the ongoing torment of waiting and hoping to no avail. Now 
at least there was an end and they could begin to rebuild their 
shattered lives. Later on that day they would hold a press 
conference, and Matthew admitted that he wished he'd never 
arranged it. But people had to be thanked for their support and 
grief made public. It would help all of them come to terms with 
what had just happened. Cathline, Alex and John had gone on 
ahead while they stayed behind to sort the remaining legal 
details out. Elizabeth's official time of death was 13:18GMT, 
which was just as Kat wanted it to be.

Another thing that brought them a little comfort was the fact that 
Elizabeth had had her family with her when she had died. It 
would have been so much worse for them had she died alone 
and terrified in that farmhouse a few weeks back. True it was 
small comfort, but at this time they took any that they could. In a 
few hours time Elizabeth's body would be taken to the local 
funeral directors for preparation and from there be flown to their 
island in the Maldives for burial.

They met the rest of the family at the hospital reception desk. 
Alex was sitting down on a nearby chair and was being 
comforted by Cathline. John was sitting next to them, staring 
into space in shock. There was no smile from Cathline as she 
saw Matthew and Kat walk in, just a simple nod of the head as if 
to say 'Is everything sorted out?'

"We just want to wait and thank Dr Atkins and the rest of the 
staff who looked after Elizabeth," Kat said softly.

"We know. We were told they'd be out in a few minutes and let 
us know how many lives Elizabeth would save," John said as 
stoically as he could muster.

"Anyone want a coffee?" Matthew asked. He just needed a short 
break away to compose himself some more.

There were various orders thrown at Matthew, and in his 
shocked state he had trouble remembering them. After another 
slower repetition of the order, he went off in search of a vending 
machine. 

It took Matthew a few minutes to find an old looking vending 
machine, but at least it was still working. He fumbled in his 
pockets for some change with which to buy the drinks. Carefully 
reciting the orders he primed the machine with change and the 
machine proceeded to pour the alleged coffee into small plastic 
cups. He used the last few euro-cents to buy a small disposable 
tray and walked back to the reception. 

He knew something wasn't quite right when he heard excited 
voices from where Kat and the others had been. Dr Atkins and 
other medical staff were surrounding Kat and were looking to be 
explaining something. He caught a glimpse of Kat's face. She 
was smiling for the first time in weeks!

Matthew rushed over as best he could to see that the 
commotion was. He quickly put the tray of drinks onto the 
receptionist's counter, and pushed his way thru to be alongside 
a joyous Kat. "Kat, what's going on?

"A miracle!" Kat said and gave Matthew a large hug.

Matthew returned the hug but was still confused. "Kat, please 
tell me."
 

"Elizabeth's started breathing again!" Kat exclaimed, and gave 
Matthew a large kiss.

"How?" Matthew exclaimed and returned Kat's kiss. 

"That's what Dr Atkins was trying to explain when you walked in," 
Cathline replied. 

Dr Atkins shrugged his shoulders "Ok, for Mr Stephen's benefit 
I'll start again. As you know we took Elizabeth's body down to 
remove the organs for transplant. We were just about to make 
the first incision, when a colleague noticed her chest gently 
moving up and down. We immediately took pulse and 
respiration measurements and although not normal were 
slowing rising. Straight away we put her on a ventilator to help 
her out but she didn't seem to need it. Now she's gone in for 
some tests to see the extent if any of brain damage and to find 
out what the real picture is. I can't explain this at all."

"How long before we know?" John asked.

Dr Atkins checked his watch, "The brain scans will take about 
an hour, the internal ones should be done in the next few 
minutes."  

"So is she going to wake up?" Alex asked hurriedly.

"From the initial results I don't see why not. But there could be 
significant brain damage. The only thing I can tell you is that she is 
breathing normally and on her own."

"When can we see her?" Matthew asked. The turn around in 
events still had him stunned and overjoyed.

Dr Aktins thought for a few moments, "Soon. You know where 
the briefing room is. I suggest you go, take your drinks and wait 
until we have some news for you." 

"Deal!" Kat broke into a smile and shook Dr Atkin's hand. 

When they were in the privacy of the briefing room Kat allowed 
herself a few tears of joy. She KNEW Elizabeth was still alive! 
Somehow, deep down in herself she had known. "She's alive 
Matthew. I don't know how come, but thank God she is!"

A multi-way conversation ensued with everyone exclaiming their 
joy, but puzzlement as to the reason for the sudden upturn in 
Elizabeth. About an hour later Dr Atkins and a neuro-consultant 
walked in. Matthew noticed that Dr Atkins was holding a large 
brown envelope under his arm. "What's the news?" Alex said 
excitedly.

Dr Atkins took two large photographs from the envelope and 
placed them on a nearby table. "To say I am stunned is an 
understatement. From the scans we took earlier on today it 
looks as though Elizabeth's lungs and heart have completely 
healed themselves, and there is no sign of internal scarring or 
bleeding. She still has a smashed rib but that's not life 
threatening."

"And brain damage?" Kat asked hesitantly.

"This is the confusing part. I'll hand you over to Dr Renton here 
who will try and explain," Dr Atkins indicated to the neuro-
consultant who nodded in recognition.

"Ok, this plate here is of the brain scan we took when Elizabeth 
was first brought in," Dr Renton said indicating to the left hand 
side photograph, "If you notice this small dark area here. This is 
some kind of disorder, but we can't be sure without further 
study."

Kat knew what it was. She'd seen that mark a number of times 
before. But she didn't say anything.

"Now on this plate," Dr Renton pointed to the right hand 
photograph. "There is no mark at all. Whatever disorder had 
been in place is no longer there!"

Matthew was staggered. "Are you telling me that somehow 
Elizabeth's body has repaired it's self and cured this brain 
disorder?"

Dr Renton nodded, "That's what I'm telling you. My best guess 
is that her body was using everything it could to repair the 
damage, and that's why she needed the bio support systems 
more and more. I'm aware of her unusual origins. Is it possible 
Dr Bexley gave her some kind of enhanced healing ability when 
she created her? That's the only reason I can think of because 
as it stands that's the only way this was possible."

"I've no idea what Dr Bexley did to her before she implanted her 
in me. Whatever it was we all owe her one," Kat said softly.

"So when will she wake up?" Alex asked again. 

"She's sleeping peacefully now. Her body has gone thru 
massive trauma, but she'll be fine. She's still in a side ward on 
her own so you'll have some privacy. Because she's had no 
activity for a number of weeks she'll need to gradually build her 
strength up before we can move her. Good job she looked after 
herself as this has helped her enormously."

"Is she off the machines?" John asked.

Dr Atkins looked at a concerned John and said "She's still 
connected but that's purely precautionary. If all goes well we'll 
disconnect her tomorrow."

"Can we see her?" Matthew asked excitedly.

"Sure, Now we've finished the tests. Try not to wake her just yet 
though, so it'll have to be one at a time." Dr Atkins replied.  

"Me first," Kat demanded.

-- o -- o -- o --

The next morning it was Alex's turn to see Elizabeth. The 
previous afternoon they had all quietly filtered in one at a time 
and paid their respects to the now sleeping Elizabeth. Her 
deathly gray pallor at had gone, and although she looked far 
from her normal glowing self she was definitely better than she 
had been for some time. The get well feelings they shared 
with Elizabeth were muted, as they dare not wake her. Alex had 
been dying to give Elizabeth a hug, but had to hold back. As he 
walked into the side room he noticed with great relief that she 
had been disconnected from the bio support systems, and that 
for the first time a plastic breather mask didn't cover her face, 
and that she was breathing freely.

Alex sat down on the chair next to Elizabeth. He'd just met 
Matthew on his way out and he'd told her that Elizabeth was still 
fast asleep. Alex adjusted his chair and leaned forward. "Well 
Kiddo you always wanted to get one up on me, and I must admit 
you've got me beat this time. You had me going for a while 
there," he whispered, not wanting to wake Elizabeth.

From the corner of his eye he noticed a slight movement of 
Elizabeth's arm. It seemed to be more of a twitch than a 
conscious effort but it was the first time Elizabeth had moved in 
over six weeks. "Elizabeth?" Alex asked. His voice was full of 
hope.

There was no reply but Elizabeth's muscle's on her face 
twitched. 

"Hey kiddo," Alex queried. He tried his best not to let his 
euphoria overwhelm Elizabeth.

A quiet, almost silent whisper replied, "I told you not to call me 
Kiddo."

Alex leapt up and gave Elizabeth a hug. "I missed you!"

To Alex's dismay and puzzlement Elizabeth turned away from 
him. "No Alex please, Where am I?" she asked.

"Hospital. You were shot!" Alex explained. He saw to his relief 
that Elizabeth had opened her eyes and was now starting to 
focus on the room around her. How he'd missed her blue-gray 
eyes, sparkling full of life and intelligence. He'd have swapped 
his own life just to look at them again and now they were looking 
at him in deep regret and sadness. But why?

"Shot?" 

"Shhh, rest," Alex said and tried to kiss Elizabeth but again she 
moved away.

"No Alex. It wouldn't be right. Where's Mom and Dad?" 

'Wouldn't be right?' What the hell was Elizabeth talking about? 
Alex decided against his feelings that it was better to let it drop.

"They'll be here soon. I'll call and tell them you're awake. I'll go if 
you want me to," Alex said. He didn't want to leave, but 
Elizabeth looked so tired.

"Tell them I love them. Alex, please go and be with them. I'm so 
tired." With that the blue-gray eyes closed as if closing the 
conversation.

Alex was upset. His initial joy and jubilation had evaporated as 
quickly as it had arose. Why had Elizabeth been so cold towards 
him? Didn't she love him anymore? These were questions he'd 
need the answers to quickly, but only when Elizabeth was ready 
to talk. In the meantime Alex stood up and once he was outside 
the hospital called Cathline on his PDA.

Alex only had to wait a few minutes and soon spotted Cathline, 
John, Kat and Matthew walking from the hospital car lot. He ran 
towards them and shared what had happened with them. In all 
of this Cathline was unusually subdued, but Alex put it down to 
a mixture of exhaustion and relief.

"So she's gone back to sleep?" Kat asked.

"Yeah. Look why don't we go to hospital restaurant for a coffee? 
We'll give her an hour or so before we look in again. It was odd 
but she doesn't remember being shot!" Alex replied.

Cathline reminded Alex, "She's still in shock. She may be awake, 
but she's not better." 

"I guess."

-- o -- o -- o --

After spending two hours drinking tasteless and tepid coffee 
they decided it was time to see how Elizabeth was. Alex was 
relieved to see Elizabeth awake and sitting up in her bed. On 
seeing Matthew and Kat, Elizabeth broke into a huge smile and 
whispered "Mom, Dad, John, Auntie Cathline!" 

Kat struggled to fight back her tears of joy and she towards 
Elizabeth and gave her a hug. Elizabeth returned it, albeit 
weaker.  "Mom you came!"

"Try keeping me away. Elizabeth you gave us such a scare. Are 
you ok?" Kat asked. She felt the tears start to form again but 
blinked them back.

"Just A little tired, that's all. What happened to me?" Alex told 
me I was shot but I don't remember it at all."

"It's ok. it'll come back," Kat comforted Elizabeth. 

Elizabeth's face dropped a little when she looked at Alex, "Alex 
would you mind finding a nurse for me. I could do with some 
more water. Actually an OJ would be better."

Glad to be noticed Alex perked up, "Sure." 

Elizabeth waited until Alex had left the room. She reached over 
to her left hand and with a little tugging removed her 
engagement ring. She carefully placed it on the tray in front of 
her. "When Alex gets back I want you to give this to him."

Cathline was shocked. She glanced around at the others and 
they were just as shocked as she was. Kat even more so.

"Why?" Kat stammered.

"I think you know why. All of you do!" Elizabeth sneered.

Kat looked at Elizabeth with concern, "Honestly we don't! When 
we last saw you, you couldn't wait to get married! What's 
changed? We don't mind if you have changed your mind. It's 
much better that you do this now if you have to, but we're just 
staggered that you'd call it off. Alex was there with you for fifteen 
or twenty hours at a stretch. He adores you Elizabeth."

"I know and that's what makes it so hard. But I can't marry him, 
not now, not ever!" Tears formed in Elizabeth's eyes.

"Why? Cathline asked.

Elizabeth shot Cathline a murderous stare, "You know why, don't 
you! Angela was the one who was holding me hostage. She told 
me everything!"

"We know about Angela, she's dead. You shot her when trying 
to escape," Matthew stated softly. Why was Elizabeth doing this 
to herself and Alex? Matthew knew she loved Alex dearly so 
why was she ending it?

Elizabeth looked puzzled, "I didn't shoot anyone, and how could 
I escape? I was tied to a chair! Anyway I'm not letting you off the 
hook. Cathline you KNEW about this but didn't tell me WHY?" 
Elizabeth voice was deadly serious.

Cathline went as white as a sheet. All the color drained from her 
face and she wished the ground would open up and swallow 
her. 

"What the hell are you talking about?" Matthew demanded, 
"Cathline what's she talking about?"

Elizabeth's eyes narrowed and she glared at Cathline in fury. 
"You never told them did you? I'm surprised they never 
guessed, but its not the kind of question that you'd ask is it?"

"Cathline, What the hell is she talking about?" Kat demanded.

Cathline said nothing but her face was like stone. 

Elizabeth once again gave Cathline a hard look. A look of 
betrayal and heartbreak "The reason why I can't marry Alex, no 
matter how much I love him is because he's my half brother!"

There was a crash from the doorway. Alex had just dropped the 
glass of OJ he'd got for Elizabeth.

Alex was more than stunned. Half brother? Not Marry him? 
What in hell was Elizabeth talking about? He felt as if he'd just 
had his heart ripped out. All he managed to say is "What?" 

Cathline turned away from Elizabeth and the rest of them. Inside 
she felt an awful combination of guilt and despair. She sighed 
deeply before turning around to face Elizabeth once more. This 
was going to be hard. "She's right, in a way. Kat, you're Alex's 
father."

"Huh?" John said.

Alex's face turned to stone. How was this possible? He'd been 
told that his father was killed in the Guild war, that he had been 
conceived when Cathline was in Osman's dungeon. What the 
fuck was going on?

Cathline sat down on the nearby chair and took a deep breath. 
This was going to take some explaining, "Kat you remember 
when you were in Salah's body?"

Kat nodded, "How could I forget? Uck, all hairy and square and 
as for having a dick, well don't get me started on that one!" Kat 
was feeling deeply confused, even hurt, and was using humor to 
try and hide her feelings. 

"Stop trying to use humor to get around things mom," Elizabeth 
whispered. Already she was feeling exhausted, but she needed 
to get this out in the open. 

Kat whirled around and snapped at Elizabeth "Hey!"

Cathline looked up at her stunned friends and then turned to an 
angry looking Alex "Alex what I told you was true, to a point. The 
real Salah was killed in the Guild war. You are his son. You 
share his DNA, his noble spirit and everything that made him 
unique. I was imprisoned in Osman's dungeon and Kat came to 
me in as Salah and was forced to make love to me. Alex, you 
were conceived then."

"Why didn't you tell us?" Matthew demanded. How in hell had 
Cathline kept this quiet?

Cathline knew she was in for a hard time and immediately went 
on the offensive, "Because in reality Alex isn't Kat's son. Sure 
she performed the act, but it's not her DNA, not her essence 
that Alex shares and has. Alex is no more her son than 
Elizabeth is her biological daughter! Alex is MY son. I had the 
pain of bringing him into the world. I fed him and raised him to 
be the wonderful young man he is now. Kat, you made love to 
me and you know what? I still cling to that moment. Kat, it's one 
of the most precious times I ever had. It didn't seem it at the 
time, but a new wonderful life came from it! I didn't tell you at 
first because I simply didn't know I was pregnant. It wasn't until I 
started to show that I suspected anything. My body was so 
messed up with all the stress of the whole Fury thing that I'd 
missed a few months before anyway. "

"Why didn't you tell me later on?" Kat asked. Alex nodded. He 
was going to ask the same thing.

"Because I didn't and that's that! I wanted Alex for myself. Yes it 
was as selfish as hell, but I didn't want to share him. He's the 
only bit of light I have in my life, other than you guys. When I 
see him I see what I could have had with John and that makes 
me selfish. Kat what would you have done if I'd have told you?"

Kat was still in shock from the whole thing "Dunno. I'm still trying 
to get my head around it. I'd have probably have wanted to help 
out in bringing him up."

Cathline was still on the offensive "Which you did anyway, just 
as I did Elizabeth! Alex I'm sorry I didn't tell you the complete 
truth, but what would you have done if you had known?"

Alex was too upset to make much sense. He had searched for 
months for his father, and his mother had sat there and let him 
do it. He had poured his heart and his soul into the search, and 
its negative result had been devastating to him "My search. You 
sat there and let me look for my father, and all the while he was 
Kat?" Another realization hit him "That's why Elizabeth can't 
marry me. We're brother and sister!"

"Whose son am I?" John asked. He was trying to lighten the 
tone. The last thing his sister needed was a full on row.

Kat shot John a 'shut it' look and proceeded "But you're not 
Elizabeth's half brother, are you Alex? Elizabeth is Dr Bexley's 
daughter not mine. Matthew and I are adoptive parents not the 
biological ones."

"What about the law?" Matthew asked.

"Fuck the law. I love Elizabeth. She's only just come back to us, 
and here we are bitching about what's past. Kat you were a 
wonderful 'father' to me. Mom what you did was selfish and it's 
going to take me a while to forgive you for it. I still don't 
understand why you kept this a secret and I hope it's for a damn 
good reason. But Elizabeth is the main priority here. Let's 
redraw the family tree when she's better!" Alex snapped. 

Kat felt guilty for dragging this out. Alex was right. Elizabeth was 
the top priority. "I'm sorry. It's just a shock that's all."

"Can I speak to Alex alone?" Elizabeth asked quietly.

Cathline ignored Elizabeth's request. She still wanted to justify 
her actions to the rest of them, and hadn't heard Elizabeth's voice. 
"Maybe I should have told you."

"Damn right!" Matthew exclaimed.

Cathline took a deep breath and continued. This was getting 
very ugly very quickly, "But I had some good reasons at the 
time. This all happened twenty years ago, and after Alex was 
born, well it just didn't seem right to disrupt and jeopardize our 
friendship over it. I love you guys more than anything. You are 
my family and I didn't want to risk that."

"You underestimate how we feel about you Cathline, if you 
thought that. Hell, we've gone thru worse than this and still 
come out friends," Kat said softly.

Cathline put her head down, so her long blonde hair covered 
her face. She felt so ashamed of what she had done and what 
she was putting her best friends thru, "Kat, I'm sorry. What else 
can I say? Alex, I'm even more sorry. I should have told you but 
I thought, in my insecurity and loneliness, keeping this a secret 
was the best way of still keeping you all as friends."

Cathline started to cry. "Kat, I'm so lonely it hurts. It's ironic isn't 
it? I'm the most beautiful fifty year old on the planet, and yet I'm 
alone.  John was my soul mate and he's dead! I didn't know 
what I had in him, did I? So I played around with Dr Bexley, 
convinced myself that I was in love with her because, in my 
mind, maybe John wasn't the one. Then when John was killed I 
latched onto Kat, because as a friend she IS my soul mate, but 
you're so in love with Matthew I never stood a chance."

Cathline paused and wiped away a tear from her eye, "I told 
myself that I'd wait for John. That, because of what I did to him I 
owed it to him to wait until I met him again. But it's so hard. I 
know I was wrong to hide things away from you, but I hope you 
can understand that I was too fearful to risk throwing away my 
last remaining family."

Kat walked over and gave Cathline a hug, "Oh you silly thing. 
We ARE family. You, John, Alex, Elizabeth, Matthew, and me 
are all in the same family. Sure we're not all related by blood, 
but family is more than just flesh and blood. Family is 
relationship, trust, giving of yourself and expecting nothing back 
in return. That and a whole lot more as well! There's no need to 
feel lonely Cathline, we're here for you." 

Cathline put her hand on Kat's "You always did know how to 
sort me out didn't you?"

Kat smiled, "Friends?"

Cathline smiled and rested her head on Kat's arm, "Soul mates."

"Sorry to break this up. But I really need to speak to Alex," 
Elizabeth stated. She was glad that the initial rift had been 
healed but she also knew that there was a long way to go. But 
as Kat had so eloquently remarked, they were family, and true 
families endured the most savage of storms.

"Come on guys. Alex was right, Elizabeth needs her rest and 
we're just in the way," John said. He admitted to himself that he 
was a little overwhelmed by the news that had just been 
announced, but he knew that he had to stand with his parents 
and Cathline in this. They would work it out, they always did. 
This one would take a little time to resolve but the first tentative 
steps towards healing had been taken.

"Come on 'soul mate'," Kat said to Cathline with a smile, and 
helped Cathline to her feet. 

Cathline gave a smile and the group walked out, leaving Alex 
and Elizabeth by themselves.

-- o -- o -- o --

Alex walked over to where Cathline had been sitting, sighed 
deeply and asked, "You look exhausted. Want me to come 
back?"

"It's ok," Elizabeth said quietly.

"What did they do to you?" Alex asked quietly. 

Elizabeth thought back to the horrific revelations that Angela 
had assaulted her with. "Do you hate who I am?"

"Pardon?" Alex asked.

"Angela, she told the world who I was didn't she?" Elizabeth 
said quietly. 

Alex nodded, "Somebody did. BUT it doesn't matter. That's old 
news now. You being in that coma spared you of the full 
spotlight of the media. You didn't hear what I said to you the first 
day I found out, did you?"

"What was that?" Elizabeth asked. Had Angela been right? Was 
any chance of a normal life over and done with? Alex was right 
about one thing. Being in a coma had spared her an 
enormous amount of hurt and questions from the media. Sure, 
the subject would come up again, but the initial sting had been 
removed.

"Umm let me think," Alex said. The memory of pouring his 
heart out to an almost dead Elizabeth was still fresh in his mind. 
But now he had had the biggest shock of all. She no longer 
wanted to be his wife. He had really thought their love was 
stronger than that. He had poured out so much to her 
over the past six weeks that it had all merged into one. Then it 
came to him "I think it went something like this

'I don't know if you can feel this ring still on your finger but it's a 
sign of our love for each other. It tells the world we are meant to 
be. I don't care whose cells you came from or what DNA you 
have, I just want you back with me. Kat and Matthew showed me 
and you that love can cross any boundaries, outlast the fiercest 
fury and endure the greatest pain.'"

Elizabeth was silent. Deep down she still loved him but no 
matter her feelings for him -- Alex was still her half brother. They 
shared the same parent. "Do you still feel like that?" she asked.

Alex looked into Elizabeth's blue-gray eyes. He felt more in love 
with her than ever, so why didn't she love him any more? "More 
than ever, especially now. Elizabeth I'm still confused. Why don't 
you tell me what happened from the start. If you are still up to it 
that is. The police will be here in a few hours to take a statement 
so it'll help you if you tell me." 

Elizabeth shuffled herself in the bed, trying to get comfortable. 
Alex got up and helped her adjust her pillows. Once Alex had 
sat back down again Elizabeth started to explain.

"I remember walking into my dorm and finding the lights out and 
not working. I found Angela lying on the floor and called to my 
PDA to activate the alarm but it didn't work. I felt myself being 
grabbed from behind and then it all went black. I've no idea how 
long I was out for but it must have been several hours. I awoke 
in a room and after a short while I saw a figure walk out from the 
shadows. Alex, it was Angela. She betrayed me! She was a 
plant all along. Everything she did, her friendship with me was 
all a sham."

Alex looked puzzled "For what reason?"

"So that the Children of Bexley could force me to become Dr 
Bexley," Elizabeth said softly. The torrent of hate, fury and 
emotion she had felt when Angela was betraying everything she 
had held dear was still very vivid in her memory.

Alex thought for a few moments, "Because you had the same 
flaw in your brain as Dr Bexley had? They wanted to get you so 
angry and upset that it would provoke that flaw."

Elizabeth nodded, "Angela had switched my medicine around 
and made it impossible for me to take any more. Alex it's not 
just that you are my half brother that I can't marry you, it's 
because I'm afraid of what I might do to you!"

Alex thought back to the scan's he was shown "Don't be. 
Somehow the flaw or whatever you call it is gone. We were 
shown two scans before and after. The after shows no flaw."

Elizabeth's face screwed up with confusion. "How is that 
possible?"

Alex shrugged. "The doctors said Dr Bexley might have 
enhanced your healing ability. Anyway, what in hell did Angela 
tell you?"

Tears formed in Elizabeth's eye, "Everything. She pulled my life 
to shreds, methodically and without remorse. She told me how 
she'd been trained to do this to me from an early age, forged 
some entries from Dr Bexley's diaries, and planted evidence 
that would seek to confuse me. Alex I did a terrible thing!"

"What's that?" Alex asked cautiously.

"You remember, I was looking into what really happened to Mom 
and Dad all those years ago?" Elizabeth said.

"Yeah and I told you not to bother," Alex said. 

"I wish I'd have taken that advice. You told me it would lead to 
fire and pain. How right you were! In my mind I created a 
simulated Dr Bexley. She would be Dr Bexley in thought, mind, 
and deed. I gave her a name."

"Deianeria? I thought that was just the name of the project?" 
Alex asked.

Elizabeth nodded, "She was more than a project. She was part 
of me, an alternative personality. That's why I kept wearing Dr 
Bexley's old clothes. I was slowly becoming my image of Dr 
Bexley. One thing I do know is that Deianeria was utterly evil.  
Even more so than Dr Bexley ever was. The only word I could 
use to describe her is demonic. I'm not saying it was 
supernatural or anything like that, but sometimes when she had 
returned control to me I would come back into my own mind and 
feel very aroused as though I'd just had an orgasm. Then 
afterwards I'd get nightmares of people I loved slowly dying in 
awful pain and terror. I somehow knew Deianeria would do 
those things, given the chance. She was so evil Alex. More evil 
than anything I have ever seen before or since!"

Alex took hold of Elizabeth's hand for a moment and managed 
to say "Hey, it's ok it's over now," before Elizabeth withdrew it.

Elizabeth gave a wan smile and continued, "When Angela was 
doing this to me I could feel Deianeria slowly forcing her way 
into my conscious mind. With each revelation it got stronger and 
stronger until she finally swamped me. Angela's last revelation 
was about you, and how my family had deceived me. I hung on 
as long as I could, but Deianeria was too strong.  The last thing I 
remember was Deianeria laughing as she took over my mind. 
Then I woke up here. I've no idea who shot me. Angela didn't 
even have a gun. Maybe Deianeria tried to escape and forced 
Angela into shooting me?"

Alex looked worried, "Where is Deianeria now?"

Elizabeth shrugged. "No idea. It's as though she died when I 
did. She's not in my mind anymore. Oh! I've just had a thought."

"Which is?" Alex asked. 

"If Deianeria is gone and my flaw is cured then she can't come 
back. Alex I'm safe!" the relief was evident in her voice. She felt 
as though a weight had finally been lifted off her. She finally felt 
free. For six years she had lived with the specter of Dr Bexley, 
and now it had been exorcised for good. She was a normal 
person again, maybe even for the first time ever! She had no 
reason to be afraid anymore. Elizabeth burst out laughing with 
joy, "Alex I'm free of her. Don't you see? If she's gone and I'm 
cured then I'm free. Alex this is so wonderful!"

Alex wanted to hug Elizabeth but held back, Elizabeth had been 
politely pushing him away since she'd woken up. Instead he 
gave a broad grin "Kiddo, that's wonderful."

Elizabeth's smile faded, "Alex I love you more deeply than I can 
say but how can we be married? Even if we tried to the law 
prevents us."

"Who's to know?" Alex asked.

Elizabeth turned her face away from Alex, trying to hide the 
tears that were forming, "I would. I can't marry you Alex. It's 
sick. Brother and sisters can't and shouldn't marry."

"I know. I'm still trying to get my head around it. Let me see if 
I've got this right. Ok, Dr Bexley cloned herself, and added a few 
'enhancements' and put the fertilized egg inside Kat. Correct?"

Elizabeth nodded, "Yep"

"So you are not related by blood to Matthew, Kat and John? Kat 
was your surrogate mother. Dr Bexley could have put you into 
anyone but chose Kat right?"

"That's the way I see it," Elizabeth stated.

"Now when Kat had been turned into Salah she was forced to 
make love to mom right? From that act I was conceived and 
mom didn't notice for a few months."

"That's what she said," Elizabeth agreed. She could see where 
this was leading and allowed herself a flicker of hope.

Alex tried to clarify things further. He found it helped him come 
to terms with what had just gone on. "So when Kat was turned 
back to her 'Jasmine' body then she was no longer related to me 
by blood. Mom fearing she'd alienate herself from Matthew and 
Kat etc didn't tell anyone and made up a story about another 
Guild agent screwing her."

"Yep." Elizabeth's glimmer of hope turned into a ray of light that 
was starting to wipe away her doubts.

"If you aren't related to Kat, except by adoption and I'm not 
related to Kat by blood then how in hell can we be brother and 
sister? We're not even half brother and sisters. Can't you see it? 
The Children of Bexley were wrong! The last thing they told you 
was a lie designed to release this Deianeria in you and so 
create their 'Dr Bexley'."

Elizabeth gave a whoop of joy, "Of course! They didn't believe in 
DNA modification. So how could Kat be your dad? Because if he 
were then Kat's DNA would need to have been modified to 
make it happen in the first place! The only way to explain it 
would be if DNA modification were possible, which they said 
couldn't be done! I was in such a confused and angry state that I 
didn't notice the lie buried in the truth. The bastards knew it was 
a lie!"

Alex nodded "Very clever of them wasn't it? I bet you made their 
day when you agreed to marry me. That was the key they were 
looking for."

Elizabeth studied Alex's face. He looked so tired and sad. The 
clown was gone, and in his place was someone who had gone 
thru fire and pain "They were exceptional at deception. Alex 
you're right. We're not brother and sister. I can't tell you at how 
much better this makes me feel. "

Alex had a thought, "I'm so happy for you, for us! You know Dr 
Bexley saved you. Maybe not directly, but her changing you to 
have this enhanced healing ability saved your life. She gave you 
every chance she could to live. I think she wanted you to 
succeed her, be better than her and not to make the same 
mistakes as she did." 

Elizabeth suddenly started crying. The tears were of release and 
healing rather than of sadness, "Alex you're right! It seems as 
though all my life I've lived in fear and in denial of who I am. I'm 
proud to be Dr Bexley's daughter. When people throw that at me 
as an insult I'll take it as a compliment. I was subjected to more 
emotional pain than Dr Bexley ever was, and yet, thanks to her 
and my family I've survived intact and alive! I will do better than 
she did! She was an exceptional surgeon and doctor and I'll be 
even better! That's how I'll repay her. That and this!" Elizabeth 
reached over to the tray across the bed, picked up her 
engagement ring and placed it back on her finger.

On seeing Elizabeth put the ring back on Alex stood up and 
gave Elizabeth a passionate kiss. To his joy she returned it and 
his spirit soared. They were together again, as they should be, 
as they were destined to be. He pulled away and said "I'd better 
go and tell Mom and Dad the wedding's back on, and you Kiddo 
need to rest."

Elizabeth glanced down at her engagement ring and gave Alex 
a smile,  "Don't call me Kiddo."

-- o -- o -- o --

A day or so later Mark's plane touched down at Tel-Aviv airport 
and he emerged to scorching hot sun. He'd only taken a single 
large bag with him, as his ticket was a restricted three day 
return. He had three days to find Anne before he had to return 
to the US. His first port of call was a small hotel just near the 
university campus. Not only was it cheap, it was an excellent 
base from which to try and find Anne. Pushing his baggage cart 
he hailed a cab, told the cab driver the address, laid back, and 
tried to unwind. He would have a shower, change and then after 
a bite to eat go find Anne. Inside he felt empty and lost. A 
number of times he'd spotted a head of long blonde hair and 
thought it might have been Anne, but on further investigation it 
proved not to be. Feeling thoroughly miserable he put his 
earpiece in his ear and selected a track of music from his PDA. 
He'd been listening to some of Anne's taste in music. It had 
helped him feel a little closer to her somehow. Thinking back to 
his trip from the airport and how he had felt these past few 
weeks he had just the track in mind, "PDA play track 18 
personal collection," Mark adjusted the volume in his PDA and 
listened to the old rock ballad

        'Loneliness is your only friend. 
        A broken heart that just won't mend, is the price you pay. 
        It's hard to take when love grows old. 
        The days are long and the nights turn cold, when it fades 
        away. 

        You hope that she will change her mind, but the days drift 
        on and on. You'll never know the reason why she's gone. 

        Empty rooms, where we learn to live without love.
        Empty rooms, where we learn to live without love.
        Empty rooms, where we learn to live without love.

        You see her face in every crowd.
        You hear her voice, but you're still proud, so you turn 
        away.

        You tell yourself that you'll be strong. 
        But your heart tells you, this time you're wrong. 

        Empty rooms, where we learn to live without love. 
        Empty rooms, where we learn to live without love. 
        Empty rooms, where we learn to live without love. '

Mark looked outside at the bustling city around him. Would Anne 
have him back? He didn't know, but he had to try, otherwise his 
life would be full of ifs and maybes. He closed his eyes and 
listened to the end of a long guitar riff.

        'You hope that she will change her mind, but the days 
        drift on and on. You'll never know the reason why she's 
        gone. 

        Empty rooms, where we learn to live without love. 
        Empty rooms, where we learn to live without love.
        Empty rooms, where we learn to live without love.
        Empty rooms, where we learn to live without love.'

The cab drew up alongside an old looking hotel. It looked as 
though it had survived the fires that had ravaged much of Tel-
Aviv He took his bag out from the cab, paid the driver and 
walked inside.
 

The polite way to describe the hotel was basic. It didn't have 
voice activated lighting or even air conditioning, but it did have a 
bed and an almost clean shower. Mark washed a few hairs from 
a previous user down the drain and proceeded to unpack.

His most disturbing discovery was a small puddle shaped stain 
on the green carpet. It looked as though it had been washed 
several times, but the stain was still visible in broad daylight. 
Mark knew what the stain was. It could only be one thing. It was 
the remains of someone who had been killed during the Guild 
attack twenty odd years ago. Mark didn't want to think about it, 
so he put his bag over the stain. At least he wouldn't have to 
look at it everytime he walked in. Mark stripped off, ran the 
shower for a few seconds until he'd got the right temperature 
and stepped inside.

An hour or so later a freshly groomed Mark stepped out of the 
hotel and hunted for the cheapest place to eat he could find. 
Even with Wills's money this trip would stretch his finances to 
the limit. He eventually found a McDonalds-King which was 
about his financial limit and sat down for a Big McKing and fries. 
After one bite he knew he could still be in Haverford. They all 
tasted the same wherever you went. He checked his watch. It 
was 17:00 local time so if Anne was anywhere she would be 
about to leave the lab. He fished out his PDA, now was the time 
to try out his new Israeli GPS guidance module. More expensive 
models of PDA had a global version built in, but he'd spent 200 
bucks on this. It would save him time in trying to find his way 
around Tel-Aviv. "PDA take me to the Life sciences faculty Tel-
Aviv University."

The PDA's screen lit up and a small arrow pointed straight on. A 
small distance reading showed in the top right. It was 1201 
meters away. Cramming his mouth with the remaining part of his 
burger he set off, following the directions of his PDA.

It took him ten minutes to walk to the right building and strangely 
there were few students around. Still, he stuffed his PDA in his 
pocket and went inside. The inside of the faculty was much like 
the one back at Haverford, but the bright late afternoon sun 
made it seem much brighter than the halogen lit interior he was 
used to. 

Eventually he found a notice board and was studying it, trying to 
find a class or a room where Anne might be found. Somebody 
tapped him on the shoulder, which had the effect of making him 
jump out of skin. A tall but elderly man stood in front of him. The 
man's bright but intelligent looking eyes studied Mark for a few 
seconds before the man asked, "Can I help you?" The man had 
a heavy Israeli accent and it took a few seconds for Mark to 
understand it.

Mark composed himself and said, "I'm a close friend of an 
American student called Anne Baxter. I'm trying to find her, do 
you know where she is?"

The man looked at Mark and weighed him up. Deciding he 
looked ok the man took out his PDA, and spoke to it in Hebrew. 
Mark waited a few moments, hoping that the man would tell him 
where Anne was.

The man gave Mark another look and said "She's out with the 
research ship 'Easu' She'll be back in two days. Have you tried 
mailing her?"

"Yes I have. Where's she due to dock?" Mark asked. He tried to 
contain his excitement. Anne was here!

The man consulted his PDA, "The 'Esau' is due to dock at Bat 
Yam harbor at 10:30am"

To the man's surprise Mark shook his hand, and thanked him.
Mark ran out of the building. Two days was nothing, he would be 
there waiting for her when she came back. He just hoped his 
money lasted that long. It would be a close call but he hoped he 
had enough time to win her back before he had to fly out.

-- o -- o -- o --

Anne sat on a deckchair, on the stern of the research ship 
'Easu'. It felt good to be back on the ocean again. She'd missed 
the freedom these last few months and although the 'Esau' still 
had no re-breathers, it didn't matter, she could dive and that was 
enough for her to start to relax. She'd just finished the final proof 
read and now, finally her paper was complete, the evidence and 
proof were safely stored in a lab on campus. Even if that were 
destroyed, she still had documentation that proved she was 
right. Anne reached down, picked up a glass full of cold orange 
juice, and looked out to sea. The sun was starting to set and 
tonight they would be heading back to Tel-Aviv. She would wait 
until she had access to a secure land based portal before 
sending her paper in. That way she would have an audit trail 
proving she had written and sent it. 

As she watched the bright orange sun cast rippling flames of 
light over the surface of the sea she wondered how Elizabeth 
was doing. Either her plan had worked or she was dead. It was 
as simple as that. Matthew and Kat would never know it was her 
that had both shot and saved Elizabeth. In some ways she 
wanted to tell them, share their relief and excitement, but she 
had vowed to stay away if she could. Maybe she would visit 
them as Anne Baxter in a few years time, just to see if they 
were all ok. She gave a smile. That might be fun. Play cat and 
mouse with Kat, dropping subtle hints but not actually letting on. 
Anne pulled out her PDA from under her chair and got it to 
search the newsnets.

A few seconds later a list of hits came up on screen. Anne 
selected the top one and a report from the European new 
agency displayed the story of Elizabeth's miraculous recovery.

        'Doctors treating Elizabeth Stephens are still both shocked and 
        puzzled at her remarkable recovery.'

Anne gave a wide grin. She done it! She read on.

        'Ms Stephen's wounds have almost completely healed and 
        furthermore a previously undetected genetic flaw in her brain 
        had also been cured.'

That should keep Heinlein happy. With no flaw there was no risk 
of Elizabeth relapsing into that monster Deianeria. If the flaw 
were still in place Elizabeth would still be in mortal danger. Anne 
read on

        'The doctors treating Ms Stephens have reached the conclusion 
        that her remarkable recovery was cause by a previously 
        unknown genetic modification to her metabolism and recovery 
        systems at the time she was cloned from the late Dr Bexley."

Anne gave a wry smile, "Right person wrong reason," she 
whispered to herself. Anne finished reading the rest of the news 
report 

        'Ms Stephens will spend several months convalescing and in 
        physiotherapy, but it said to be in good spirits and looking 
        forward to her marriage to her fiancée Mr. Alex Richards. A date 
        for the wedding has not yet been set, but it is thought to be 
        almost certainly after she has completed her medical degree."

Anne's heart soared. Elizabeth was still going to marry Alex. 
That was wonderful news! She thought back to her musings on 
visiting Matthew and Kat. She would visit them on the eve of 
Elizabeth's wedding. How could she stay away from that one?
Anne went back to the main news search list on her PDA. One 
entry caught her eye it read 'Salah autopsy is the final nail in the 
Children of Bexley coffin.'

        'An autopsy of the Guild leader Salah has revealed rock solid 
        proof that DNA modification is indeed possible. This 
        comprehensively defeats the theories of the ailing Children of 
        Bexley cult, whose main evidence was the lack of proof that 
        DNA modification was possible. The Guild, who had arranged 
        for the body to be exhumed, stated that it was Elizabeth 
        Stephens who had instigated the request some months before.'

Anne stopped reading "The little minx," she said to herself with 
some admiration. Elizabeth had done precisely what she would 
have done to kill the cult for good. Such a request wouldn't 
come cheap though. Anne read the rest of the article. 

        'The effect on the already declining membership of the Bexley 
        cult has been catastrophic. With their leader missing and 
        disgraced, and now this, it seems it can only be a matter of 
        months before they are forced to close. Matthew and Jane 
        Stephens have declined to comment on this matter but it must 
        come as some relief to them to know that their adopted 
        daughter is now safe once more.'

Anne gave another smile of admiration. "Take after your mom 
don't you. Very neat Elizabeth, very neat indeed," Anne picked 
up her glass of orange juice and raised it in a toast "To you 
Elizabeth."

Anne stretched out her long legs and looked back out to sea 
once more. The light was starting to dim and the fiery orange 
glow of the sunset had faded into a deep, dark orange. Reading 
about Elizabeth had lifted her spirits. There were times when 
she had thought Elizabeth wouldn't make it, but now she had it 
made her feel so much better. Her thoughts turned inwards. She 
had been so busy these past few weeks she had had little time 
to feel lonely or even introspective. Her work had been 
everything to her, and now it was complete a feeling of 
anticlimax was starting to set in. Sure a few days from now 
when people had had time to read and digest her paper all hell 
would break loose in the fields of marine biology, ecology and 
genetics. It wouldn't do much for the mining companies stock 
either! 

If her work life was looking up her personal life was still in 
tatters. Images of the cult leader, his intestines exposed, 
swearing at her in pain, came into her mind. She had been right 
not to wait for Mark. He didn't deserve her. Nobody did!
Why was it she could save the life of others but not when it 
came to her own? 

-- o -- o -- o --

Mark waited on the quayside for the sight of the 'Easu' coming 
into dock. He had no idea what it looked like, but he guessed 
he'd know when he saw the name on the side. He checked his 
watch. She was half an hour late in docking, but there was still 
no sign of her. He was down to his last twenty dollars in US 
currency, and his credit limit was all but gone. If Anne didn't 
show by midday he would have to leave without her. He tried to 
relax and enjoy the sunshine and the gentle 'clink click' sounds 
of the boats in the harbor, but he was finding it hard to 
concentrate.  Being broke in a foreign city was much worse than 
being broke at home. 

He had managed to see a little of the city during his stay. The 
museum and memorial for the victims of the Guild attack was 
free and open for all.  It was a heartbreaking place to visit. The 
only piece of film footage that existed was the well known shot 
of a loud explosion in the sky and the sudden appearance of a 
fine mist. A few seconds later the camera had panned to people 
on the street slowing starting to dissolve and scream in pain as 
the genetic warhead took effect. Ten seconds later the camera 
was dropped as the person holding the camera succumbed to 
the effects of the warheads. The Camera had continued to film 
the carnage and remains of the population was killed around it. 
Somehow the footage had survived the fires that had ravaged 
most of the city, and now this was the only record of the attack. 

Mark had read about how the heroic nation of Israel had 
responded with a daring nuclear strike on Cairo and then in an 
act of divine forgiveness had held back from destroying the Arab 
nations. There were still trade and travel embargos between 
Israel and Egypt, which was why he'd needed a new visa. He 
thought it interesting that Anne's involvement in the whole thing 
had been played down so that she was just a minor figure, an 
addendum. Mark thought that the shame of obliterating the 
entire city of Cairo by mistake was a wound that still ran deep. It 
was also interesting that the Israeli government was trying to put 
the best spin on it they could. Slaughter on a massive scale was 
a difficult stain to remove.

Mark didn't mind the inaccuracies. Only one person 
knew the whole truth and he was hoping to meet her! He did 
feel nervous, as nervous as he had on their first date. This was 
his last chance and he didn't want to blow it. He'd thought a lot 
about how he felt about Anne over the past few days. In his 
mind he had decided to keep calling her 'Anne', even though 
she wasn't born with that name. It was, he felt an important 
distinction. It helped him separate what she had been in the 
past to what she now was. He didn't like to dwell on the past, it 
served no good whatsoever. Wills had asked him how he felt, 
wanting to be with a woman effectively older than his mother, 
and he'd replied that he didn't see it like that. You were as old as 
you felt and acted. It wouldn't matter anyway, only Wills and 
himself knew about Anne, and there was no way Wills would tell 
the truth. Who'd believe him anyway?

Mark was feeling hungry. He'd existed on junk food for the past 
couple of days for the sole reason that he couldn't afford to eat 
out. Mark stood up and walked a few paces in a circle. His legs 
were getting a little stiff from sitting down for the past two hours. 
Suddenly, in the corner of his eye he saw a tall woman with 
blonde hair. The woman had tied it back into a pony tail, but she 
was unmistakable. She was helping the crew of large trawler 
type boat unload some trunks of some description. Unseen by 
Mark, Anne had arrived and was nearly ready to leave. In his 
mind he had imagined watching Anne majestically sailing in, and 
her leaping into his arms when she had docked. He knew that 
was a false picture, but it was one he'd clung onto. Still there 
was no time and he ran towards her, gathering his thoughts as 
he went.

Anne was just being handed a heavy looking box when she 
noticed someone running towards her. That someone looked a 
lot like Mark! She saw him look at her and wave, miss his 
footing, trip over and fall flat on his face. She shook her head in 
mild amusement. Mark always went to pieces when he was 
nervous around her. It had happened when she'd pulled up to 
help him with his car, and now this. Mark stood up and brushed 
himself down. His face was bright red with embarrassment. 
Anne acted as though she hadn't seen him and carried the box 
to a waiting trailer. By the time she'd done that Mark was 
standing alongside, waiting for her.

Anne turned to Mark and said, "Mark I'm sorry you've wasted a 
trip. I can't see you anymore," Anne's voice was full of hurt. She 
turned around and went to walk back to the boat. Conversation 
over!

Mark was simply devastated. There was no other way to 
describe the way he felt. Wills had sacrificed his car just so that 
he could be here. Why was Anne blowing him off without so 
much as a hello? Unable to face Anne he turned and started to 
walk away. 

Suddenly his hurt turned to anger. How dare she do 
this to him! He wasn't just one of her pawns for her to use and 
then dispose of! He had feelings and he meant for Anne to know 
them. Ignoring his nerves he whirled around sharply, and took 
hold of Anne's arm and pulled her back round to face him. Or at 
least he tried to because quicker the he could see and in a 
blinding flash of pain Anne had him in an arm lock from behind. 
"I told you to leave!" she hissed.

Fuck, she was quick, Mark thought. Ignoring the pain he felt, he 
said in his strongest tone, "No I won't go! You owe me more than 
that! Wills had to sell his car for me to get here so I'm damn well 
not leaving until we talk this over. Who the fuck do you think you 
are? I know who you think you are, and I've come to tell you that 
you are someone different! Now do I get my conversation or do I 
tell everyone what I know."

Anne pulled Mark's arm tighter, nearly causing him to cry out in 
pain. "You do that and you'll doom us all," She hissed.

"Ah yes your precious let's save the world project," Mark said 
sarcastically. 

Anne let Mark's arm go before she attracted too much attention 
from the quayside. "You've just earned yourself that 
conversation. But don't expect too much from me. It'll take me 
an hour to finish up here. You know where the university is? 
Meet me outside the life sciences faculty in two hours."

Mark's arm hurt like hell, and he moved it around to try and get 
the circulation back. "Ok, My flight leaves in four hours. If I miss 
that I'm trapped here. Until then, bye!"

"Bye," Anne said tersely. She was aware she had gone over the 
top at Mark, but that was to test him. His spirited fight back had 
shown her that he was here for a serious conversation, not some 
kind of romantic reunion. That pleased her, she would be able to 
explain to him her reasons for not wanting him close. She had 
acted on instinct when he'd grabbed her from behind and the 
fact she had nearly broke his arm proved her point. She would 
use the incidence as evidence in her case.

Mark walked towards the campus. His arm still hurt but it was 
his heart that hurt even more. He wasn't sure why Anne had 
reacted like she had, but he didn't have too long to wait. His 
PDA guided him back to the campus, it was a fair walk, but he 
didn't have the money for a cab. The walk would do him good 
and it gave time for his arm to stop hurting.

After finishing off, Anne waved goodbye to the crew of the 'Easu' 
and jumped into her hired Lotus . It didn't take her long to drive 
back to the Campus and she parked in her traditional spot, just 
outside the life science's faculty. She took a deep breath and 
calmed herself as she saw Mark waiting patiently for her on the 
steps. He looked bored and thoroughly miserable. She walked 
up him and said, "I'm sorry about the arm. You took me by 
surprise that's all."

Mark shrugged, "It's ok. It's still attached, just."

Anne looked Mark in the eyes; "I know why you came. You 
hoped to get back with me. You wanted to explain why you 
pushed me away."

Mark gave Anne a sad puppy dog look "That about covers it."

"I'm sorry but your trip here was a waste of time. I'll pay Wills 
back the money he gave you," Anne said softly.

"Why Anne? When we split up you told me you loved me. 
What's changed?"

Anne shrugged, "Nothing, and that's the problem. Look, we'll talk 
at my place. It's more private." 

Mark nodded. His heart had sank to a deep dark pit and he 
didn't feel like saying anything anymore. It hurt too much.

Anne led him to her car, and unlocked it.

"Nice car," Mark commented admiring the sleek shape of the 
Lotus. 

"Not a patch on my Porsche. This has a fuel cell, but it'll do," 
Anne said. They were making small talk, skirting around the 
issue.

They turned out of the Campus and onto a busy freeway, 
Everywhere people were going about their normal lives, "What's 
it feel like being here? You feel responsible for what happened 
here twenty years ago. It must hurt, seeing all those plaques 
everywhere!"

Anne looked at Mark, "It doesn't hurt. Nothing does anymore. 
The only way for me to live is without feelings. My heart is like 
ice and my soul is stone."

Mark looked into Anne's blue eyes and saw the hurt and pain 
she still felt deep inside her. She had covered it over by a 
veneer of unfeeling logic, but he knew she still hurt inside. "I 
went to the memorial of the Guild attack. They hardly mention 
you."

Anne nodded, "I know. Just as well. Better let the world think 
that the Guild succeeded rather than I failed. I know it's the 
other way around of course. Sure, Israel has its propaganda, as 
I'm sure Egypt does too. Listen, Mark, death follows me around. 
I wrote in my letter to Matthew and Kat that I am death incarnate 
and I still am!"

"Is that what you are afraid of? That I'll die and leave you 
alone?" Mark said. At last he saw a breakthrough.

"It's just up here," Anne said, avoiding the question and pointing 
to a set of apartment blocks. She didn't come here to have 
counseling by Mark. She came to say goodbye.

Taking the hint Mark fell silent until they had parked and had 
caught the elevator to Anne's dorm. As he walked into it he was 
impressed by the standard of it. It was decorated in a modest 
but somehow elegant tone. He would describe it as classy and 
not brash at all. 

"Drink?" Anne asked.

"Sure why not? OJ please," Mark said softly and sat down on 
the sofa. 

"Thought so," Anne gave a sad smile. Mark always had orange 
juice when he was upset. He'd described it as better for him 
than beer, and Anne had to admit he was right.

A minute or so later Anne handed Mark a glass of orange juice 
and sat down on the opposite chair. She braced herself for what 
she was going to say. "The reason why we can't be together 
isn't because I don't love you, because I do. It's because you 
were right about me."

"How so?" Mark said softly.

Anne looked at Mark, "Mercy isn't in my nature. You don't 
deserve me Mark. I'm more bad news than you can handle."

Mark glanced across at Anne. He was still too hurt to look her in 
the eyes, "That's what you told me on our first date. As for more 
bad news, that's for me to decide isn't it?"

"You do not understand," Anne said softly.

"Then help me to!" Mark demanded.

"You know what I told you about my past don't you?" Anne said. 
This was going to be hard but it was only way to make Mark 
understand.

Mark nodded, "Sure! You're Dr Bexley, you faked your suicide 
and worked for the CIA until you decided to do Marine Biology."

"I didn't tell you everything about my time with the CIA. I wasn't 
just a courier or a smuggler. They used my skills to kill people, 
people they couldn't get close to by normal means. What I'm 
saying is that I am an assassin. First I join the Guild of 
Assassins to try and take them down, and then I end up as one 
anyway!" Anne averted her eyes downwards. She had killed 
people in the name of truth, justice and the American way.

"I figured as much. It doesn't matter! That's in the past, years 
ago!" Mark said. 

To Mark's surprise tears formed in Anne's eyes. She gave him a 
tearful look and said, "It's not all in the past. That's the problem!"

Mark looked surprised. What was Anne saying?

You read about Elizabeth, my daughter's kidnap right?

Mark nodded. He had been worried about Anne.

"My old boss called me up and told me in no uncertain terms 
that the risk of Elizabeth manifesting the same MPD as affected 
me was too great. If she had the same symptoms then I was to 
kill her. If I didn't, someone with less experience would." Anne 
tried to fight back the tears.

Mark looked into Anne's eyes for the first time since he'd sat 
down, "That's horrible. So she wasn't shot trying to escape? You 
did it!" 

Anne took a deep breath and wiped her eyes dry, "I did it. I had 
no choice."

Mark gave Anne a comforting look, "But she's ok. She lived! 
Your super healing modification you built into her saved her. Or 
at least that's what the news said the other day."

"There was no such healing modification. If you remember back 
to that conversation we had when I first told you about me. I told 
you I had managed to cure myself permanently of the flaw in my 
brain," Anne said.

"Yeah I vaguely remember. I was a bit shaken up so I don't 
remember all the details," Mark said.

"After I'd left I tried to get some sleep. I was so down at the way 
things had worked out. I really thought we had something 
special, but on looking back it was for the best. I'd just woken up 
when my previous employer told me he needed me again. He 
gave me a stark choice. Subject Elizabeth to a test and shoot 
her if she failed, or let someone else do it. If someone else did 
do it then it was very likely they would make a mistake. I 
seemingly had no option. If I was to be in a position to save my 
daughter,s life I had to go along with it."

Mark shook his head in disbelief. What a horrible choice to 
make. "So that's where you went to those few days."

Anne nodded "Yeah, I went looking for her."

Mark gave Anne a puzzled look, "But she was found the day 
after she went missing. How'd you find her so quickly?"

Anne looked away from Mark, "I'd rather not talk about it."

Mark gave Anne an incredulous look, "Is it classified?"

Anne pursed her lips slightly and shook her head, "Not all of it. 
But what I did in my anger at her kidnappers was so awful, so 
horrible and so vicious it still gives me nightmares. It's why you 
don't deserve me."

Mark became slightly annoyed, "Why don't you let me make that 
decision."

Anne gave a sigh, "Please don't make me talk about it!"

Mark gave Anne a look of sympathy "If you want me out of here 
then you have to tell me. It'll help you too."

Anne shot Mark a look of resignation. Maybe it would do her 
good to tell someone, "We knew who had been behind the 
kidnapping, but time was running very short for Elizabeth's 
sanity. We knew the Children of Bexley wanted to put so much 
stress on Elizabeth that it would cause her MPD flaw to come to 
the front. That Elizabeth's alternative personality would force it's 
way into Elizabeth's mind and suppress the real Elizabeth. Just 
like what happened to me. So I went straight to the cult leader, 
kidnapped him and took him to a safe house."

"And you revealed yourself in all your glory so he told you where 
Elizabeth was being kept," Mark stated.

Anne shook her head, "I tried that. He didn't want ME back -- he 
wanted his own little controllable Dr Bexley that he could use for 
his own ends. He knew he couldn't have me, so he wanted 
Elizabeth instead. By this time I so furious at what he'd done to 
Elizabeth, and at his making out that some of the truest friends 
I ever had were murderers and liars, that flaw or no flaw I wanted 
to kill him. He still refused to tell me where Elizabeth was. Time was 
running short and I was seriously pissed off at his arrogant 
attitude."

"So what did you do to him?" Mark asked quietly.

"His main argument against the Fury was that DNA Modification 
was not possible. I showed him it was by turning him into a copy 
of the original me. I asked him again and still he refused so I 
turned him back."

Mark was horrified, "Anne that's outrageous!  Who gave you the 
right to do that to him!"

"Now you are starting to see what I mean. Still he held out as I 
verbally took apart everything he believed. By the time this had 
happened I was more furious at him and fuelled by my concern 
for Elizabeth I had to resort to drastic methods."

Mark looked shocked as he had a thought, "You turned him 
back into a woman. Is that why he can't be found?"

Anne shook her head and looked down. "No. If only. I took him 
apart bit by bit until he told me where Elizabeth was."

Mark looked puzzled. "I thought you'd already done that?"

Anne looked away from Mark, her head hanging in shame, "Not 
verbally, literally. I tortured him by removing his internal organs 
one at a time, while he was still alive and with no anesthetic. I'd 
given him drugs to ensure that he stayed conscious but that was 
the only drug I gave him. Eventually he told me, so I put him out 
of misery."

Mark sat back on the sofa in shock. This last act wasn't years 
ago or when Anne had been insane. It was only a few weeks 
old.  He was so shocked that the words refused to come out. 

Anne smiled a weak smile "Now you see don't you. Mercy is not 
in my nature. I thought I had left the past behind when I became 
Anne Baxter, built a new life as her and even," she looked at 
Mark, "fell in love. But I'm a monster. I kill without mercy, but 
then weep about it afterwards. I've not changed from all those 
years ago, have I?"

Mark tried to get away from the image of Anne slowly cutting out 
the cult leader's organs one by one. He was no medical doctor 
but he could visualize the amount of blood, gore and pain the 
cult leader had felt.  He decided to move on and change the 
subject. His brain wouldn't take it in all in one go and he needed 
to give it some time, "So you flew to England and found 
Elizabeth."

Anne nodded. "The cult had relied solely on secrecy and so only 
had one person guarding Elizabeth. I broke into the house, 
stunned her, and then confronted an unconscious Elizabeth. Not 
wanting to move I waited until she woke up. What 
confronted me there was the stuff of my worst nightmares."

"You were too late?" Mark asked.

Anne nodded. "I made a tape recording of her. Her MPD 
personality had taken over Elizabeth's mind completely. She 
called herself 'Deianeria'. After much verbal fencing I managed 
to get Deianeria to open up to me. She described how she 
would get her revenge on her parents and Cathline for ruining 
her marriage to her fiancée, Alex. She described in vivid and 
horrific detail how she would get Kat and Cathline to fuck each 
other, under pain of death. She described how she would join in 
until they had all come. Then she moved onto Matthew and her 
brother, John who had been chained up. She told me how she 
would fuck and then castrate them, give John hormones so that 
he would become female and keep Matthew as her personal 
sissy slave. She then told me how she would kill Cathline and let 
me have Matthew for my own use. She described all this as if 
she was getting really turned on by it. It chilled me to the bone 
just listening to her."

Mark breathed out, "I see. So this Deianeria was utterly evil. 
From what I've heard Elizabeth's personality had already been 
taking over."

Anne nodded,  "The worst thing was that as Deianeria was 
speaking I recognized myself in everything she'd done. The 
fucking, the emasculation and the murder I had all done. Not 
just in the past, but just recently when I mutilated the 
cult leader. I was supposed to be cured and a reformed character,
but how could I justify the methods I had used to find her? All
these years I thought I'd come to terms with what I'd done to people,
but in reality I'd buried the feelings away and ignored them. Hearing
Deianeria tell me her darkest thoughts was like listening to myself. 
Deianeria and I are so alike.  That was what made me realize 
that we couldn't be together any more."

Mark saw where Anne was coming from. It wasn't that she didn't 
love him; it came from a fear that she would hurt him, and from 
a conviction that she wasn't worthy of anyone's love. He 
decided to pick his moment before mentioning it, so he said, 
"So she failed the test."

Anne looked at Mark. Her face showing that she was hurting 
inside, "Yes. I had to find a way to save her life, satisfy my 
bosses that she was dead, and get rid of Deianeria. I'd worked 
out what I was going to do beforehand, but whether it would 
work or not was a different matter. I was desperately worried 
and almost thought she was dead a few times. You ever heard 
of the work Dr Yuri Kopaev? And the treatment I performed on 
Detective Tina Cox?"

Mark shrugged. "Can't say I have."

Anne explained, "Back in 2012 Dr Yuri Kopaev speculated that if 
you shut down the body, to a deep coma almost to the point of 
death, and then bring the person back to consciousness the 
MPD personality that was being manifest would it had 
died and shut down."

Mark shot Anne a quizzical look, "So you convinced Deianeria 
that she was dead. She then effectively died so that when 
Elizabeth came back only Elizabeth would remain."

Anne nodded, "He called it 'the cold boot' theory. It's the same 
theory as powering off a computer to clear out its memory 
before you restart it. He never got it to work right because he 
could never get the patients back again. In his paper on it he 
was convinced he could make it work and so was I. You 
remember how I cured Detective Tina Cox?"

"Nope. Sorry," Mark admitted. 

Anne put on her lecture tone of voice, "She had suffered very 
serious spinal injuries as a result of a fight with a Guild 
changeling. I had managed to stabilize her condition but she 
was still in a deep coma. The only way to cure her was to inject 
her with a very slow acting DNA modification serum. It would act 
cell by cell, allowing the body to recover after each small 
change. If it had been too fast acting the stress of the changes 
would have killed her. I used the same technique with Elizabeth. 
My gunshot had to be serious enough to place her in the coma, 
and make my employers think I'd killed her, but not so serious it 
would kill her outright. As soon as I shot her I called the 
paramedics and followed her to the hospital. I hung around the 
hospital for a day or so, first as a nurse and then as a doctor, 
making sure that her condition was ok. Her brain had almost 
shut right down and her body was on bio support. According to 
Dr Yuri Kopaev's paper she was in the ideal condition for 'a cold 
boot'. I came to her a day or so after I'd shot her, and using all 
my concentration formulated in my changeling organ a slow 
acting DNA regeneration drug. It would slowly start to heal the 
damage the bullet had caused and then heal the flaw in her 
mind. I knew the formulae because I performed the same 
operation on myself."

Mark raised an eyebrow in surprise. He'd heard that Anne was 
an exceptional surgeon and planner but this was truly brilliant 
"Anne that's stunning."

Anne shrugged the compliment off. She remembered 
injecting Elizabeth and the subsequent worry about her 
condition. "On anyone else it would have failed. I knew what her 
metabolism was, it's limits, and everything, because I lived in 
that body for twenty odd years. Her condition worsened as the 
drug slowly took resources from the mind and body with which 
to work. I had to hope that Kat would refuse the doctor's request 
to switch off the machines. If they had switched them off too 
early then Elizabeth would have died. I've known Kat for years. 
She regards life as the most precious thing there is. I gambled 
that Kat would stand firm until there was no hope at all. From 
reading the news reports, I was right. It worked Mark. It worked!"

Mark saw Anne's face light up. Maybe there was some hope for 
them after all. "It sounds as though it was one hell of a risk. You 
must have been worried sick about her."

Anne nodded. Her blonde hair fell in front of her eyes, so she 
brushed it away, "I was, but I had to get on with my project. If I'd 
delayed any longer, then more would die. I had to trust in my 
friends and Elizabeth's will to live. Anyway, it seems as though 
my plan worked. My bosses were satisfied because I had shot 
and killed Elizabeth. Elizabeth's flaw was cured so Deianeria 
could never return, and since Elizabeth no longer has the flaw 
my bosses have no reason to eliminate Elizabeth."

Mark smiled. He saw a way thorough Anne's pain. "Can't you 
see that you cured her. The world will never know the real truth 
but you saved her life. How can you be the evil monster you see 
yourself as if you did this?"

Anne looked at Mark, "Even monsters save their own children."

Mark took a sip of orange juice. His mind needed time to come 
to terms with what Anne had just told him. Anne, seeing a 
natural break in the conversation stood up, walked towards the 
window, and looked out over a bustling Tel-Aviv.

Mark stood up a few seconds later and walked over to Anne. He 
turned to face her and said "When you first told me who you 
were, I panicked. I had fallen in love with Anne Baxter only to 
find that she was Dr Elizabeth Bexley. That thought freaked me 
out, and it wasn't helped by recurring nightmares of what you did 
to those gang members."

Anne gave Mark a knowing look, "You were right about me. I'm 
not the woman you fell in love with. You fell in love with sweet 
little Anne Baxter, not who I really am. Death incarnate and 'Hell 
bitch'"

Mark shook his head, "I fell in love with you. You are older than 
me, but so naive."

"How so?" Anne said, and returned her gaze to the view of Tel-
Aviv.

"You know, there's an old adage that says 'get a life' You need 
to get yours back again! You think you have some ideal to live 
up to. You spend all your life trying to make up for what you did 
in the past. You turned Matthew back and tried as best you 
could to make up for what you'd done to him. You then try and 
stop the Guild because they were going to use your invention as 
a weapon, and then after Tel-Aviv and Cairo have been 
destroyed you start a new life as Anne Baxter and try to save 
the worlds Oceans. You've spent the last thirty years trying to 
make up for your mistakes. You murdered those gang members 
and the cult leader so you save your daughter's life to try and 
make up for it. Your only achievement in the past thirty years of 
getting yourself sorted out is to find different and better ways to 
run away. 'I need to go and find my own path, only I know what's 
good for me.' What a load of self-indulgent crap! It's time you 
had a life rather than just lived one!"

"So what of it. I have to at least try," Anne snapped. Mark's 
words had stung deep. But what she couldn't refute was that 
they were true.

Mark stood closer to Anne, She needed to know he still cared 
for her, "Yes but you do it at the expense of those who love you. 
You punish yourself because you feel you deserve to be 
punished. You not wanting me around has nothing to do with 
you being a monster and merciless killer. It's more to do with 
you not feeling worthy to have anyone love you. I spent months 
in a fit of self pity because I thought I had lost you for good. It 
wasn't until I came through it that that I realized that love is deeper 
than just self absorption, infatuation and a bulge in my pants!"

Anne remained silent. Marks words started to eat into her soul. 
He had a point of course. But to open her heart fully up to him 
was a big step. She turned towards Mark once more and said, 
"You don't think I've thought of all this? You don't think I've 
tried all of this before?" Anne tried not to let sarcasm creep into 
her voice.

"Yes but every time you've tried it it's only been you. You've 
been pulling on your own resources and yours alone. Sure 
you've read around it and studied counseling theory, but it's only 
been you. Anne, how do you really feel?"

Anne turned to face the window once more. "I feel old. Worn 
out."

Mark put his arm around Anne's waist and to his surprise she 
didn't pull away, "Let me make you feel young again. Maybe the 
reason why you've not been able to see your way clear is 
because it's not a job for you alone. Anne, let me into your 
heart."

Anne shook her head, "I can't! My heart is ice and my soul is 
stone. You said you were in love with Anne Baxter. She's only 
an alias."

Mark pulled Anne closer, "No she's not! Wills made me see it 
and it's why I came here rather than just walk away. You 
couldn't live the life of Anne Baxter for five years without her 
being the real you. Nobody can act that well, Anne Baxter is 
how Dr Elizabeth Bexley is now, not how she was fifteen, twenty 
or thirty years ago."

Anne turned to face Mark, her eyes moist with tears, "Then 
Anne Baxter is a monster! She kills in the most brutal way 
possible and without mercy! I haven't changed at all!"

Mark shook his head, "Anne Baxter is the woman, who helps a 
stranger with his car, shows her love for her boyfriend by 
exposing her greatest secrets and fears to him. She saves the 
life of her daughter and then slips into the background so her 
daughter can live in peace with her adopted family. Anne Baxter is 
the woman who leaves her stricken daughter to work on 
something that will save an entire ecosystem. Anne Baxter is 
the woman who trusts her friends enough to leave the life of her 
daughter in their hands. Anne Baxter is.."

"Alright I get the picture," Anne said softly.

Mark looked Anne in the eyes. The tears had ceased, and a 
spark of hope was there. He smiled and said, "I'm not sure you 
do. I'm glad I wasn't there to see what you did to the cult leader 
but that side is part of who you are too. We all have our darker 
sides. That part of us we keep hidden and away from sight. It's 
the part of us that wants to dominate others, the part that drives 
natural selection onwards and the part we draw on when we 
need strength beyond what we can cope with. I think this 
Deianeria was Elizabeth's darker side unleashed and without 
restraint. That's the difference. In every case you said you did 
what you could before taking the final step. With those gang 
members you tried to negotiate and protect me. With the cult 
leader you tried the thing most likely to get him to talk first. From 
what you've told me you use force as a last resort. That's not 
acting in an evil way is it?"

"You're only saying that to make me feel better," Anne said 
softly.

Mark smiled and took Anne's hand. Again she didn't pull away, 
"I've had weeks to think about this. I'll say it again, you've spent 
years trying to sort this out yourself and by yourself, and it's not 
got you anywhere but deeper in. You need to move away from 
thinking me, me, me but you can't because you are not capable 
of getting away from yourself."

"I knew that's what I needed to do. That's why I love you. You 
made me feel like my original me again. Not like Anne Baxter or 
a 'hell bitch' but like me before I met Matthew. Mark I'm so messed 
up inside I can't feel anymore. I should be crying but the tears 
won't come. I'm dead inside. You're wasting your time with me."
 

Mark pulled Anne closer towards him, "Wasting my time? If I 
thought that I wouldn't have plunged myself into debt, called in 
every favor I can, and flown 8000 miles to see you, would I? 
Anne what you've told me today and beforehand only confirms 
what I knew from the first time I saw you, that you are a most 
remarkable woman."

Anne pulled back, away from Mark, "What you're trying to do 
isn't going to be achieved in a few hours talking or even a few 
weeks. I can't ask you to do this for me."

Mark looked into Anne's eyes and his heart soared. She was 
looking at him with an expectancy and hope that had been 
missing for so long, "I'm not asking this to be a short term thing 
and you didn't ask me to help. I'm offering it because Anne 
Baxter or whoever you are today, I'm so deeply in love with you 
that I can't imagine living without you."

Anne gave Mark a look. He didn't know what he was letting 
himself in for. But was he the ONE? Her instincts told her he 
was. Her heart or what was left of it told her he was. So why did 
she still feel unsure? One thing she did know, and that was that Mark 
loved her. She had told him everything she had done and he 
was still willing to stand by her. That told her something. Maybe 
he was the right person to melt her heart and turn her stone 
soul back to flesh. She was in love with him, that much was 
clear. He made her feel young again, as though the fury and its 
consequences had happened to another Dr Elizabeth Bexley. 
He had Matthew's innocence but none of his naivete. He shared 
Matthew's compassion and heart but was prepared to stand with 
her rather than flee.  Mark's trip to be with her in Israel proved 
that. Mark wouldn't jilt her or run away. He would stand 
alongside her no matter the consequences. She pulled him 
closer so that their noses were almost touching, "I hope You 
realize I mate for life?"

Mark moved in and gave Anne a loving passionate kiss, "I 
wouldn't have it any other way."

Anne returned the kiss and felt the years fall away from her. The 
block of ice that was her heart had started to thaw and although 
it would take a lot of time, pain and soul searching, she knew 
that together they would make it. She pulled away from Mark's 
kiss and gave him a loving hug. Her eyes crying with tears of joy 
and freedom. Finally she was free.

-- o -- o -- o --

Two Years Later.

The 60 foot research vessel 'Hera' drew to a stop and with the 
help of frantic activity by its ten man crew it weighed anchor and 
drifted gently on the turquoise ocean. Inside a young man and 
his stunningly beautiful blonde fiancée stood inside the bridge 
and were reaching the climax of a hectic two years work

"I think you should do the honors," Mark said pointing to a 
switch on the bridge.

"I should think so," Anne said with a smile. 

"I still can't believed you convinced the UN to let you do this!" 
Mark said, and gave Anne a peck on the cheek.

Anne returned the kiss, "I can't believe it took them a year to 
decide! Just as well I started while I was still at college. At least 
we know have a chance!"

Mark gave Anne an incredulous smile, "A chance! Hah. All the 
results of the trials have shown a 70 percent improvement over 
your estimates. If this goes well then the decline of the marine 
ecology will be well and truly over in thirty, not sixty years! I 
must say I'm still stunned by the audacity of your scheme and I 
knew about it two years ago!"

"Well you know me, I always like to go one better than the rest," 
Anne said with a smile.

Mark shot Anne a look of admiration, "Only the great Dr Bexley 
would think of genetically modifying Plankton so they ingested 
and broke down what ever pollutants were in the water and so 
cleaned the water as they bred."

Anne gave Mark a friendly prod, "Oh come on there's more to it 
than that. I had to limit the number of generations so that they 
didn't breed out of control. Alter their shape so that the plankton 
eating animals and plants didn't die of poisoning. They also had 
to float to the top of the ocean and stay there so they could be 
collected and not let the pollution get back into the ecosystem 
again. You know the brief. I had to almost redesign the marine 
food chain to get this to work properly! That's what took the 
time, that and triple checking," As she had thought it had been a 
real battle to get her idea firstly accepted, and then recognized 
by the scientific community. At first they had laughed it off and 
then as they investigated the evidence called it grossly 
irresponsible. Anne had not given in however and the first shore 
based trials in the Black Sea had proven the idea beyond doubt. 
The water quality in the Black Sea was back to the levels of the 
late 1930's and was still improving. Thanks to her safeguards 
the effects on the ecosystem and food chain had only been 
beneficial and now at long last she was about to perform the first 
clear up of an entire Ocean.  The effects would take far longer to 
be measured but they would know for sure in ten years time. 

Mark thought back to Anne's interviews with several mining 
companies. They had seen the potential almost as soon as 
Anne's paper was published, "I liked the idea of getting this 
modified plankton to extract minerals from sea water. The 
mining companies are falling over themselves to sign up for 
usage licenses. I think I could get used to marrying a billionaire!" 

Anne smiled, "Let's not get ahead of ourselves. First we need to 
dump these forty tons of GM-Plankton 260 and then can pay 
some old friends a visit."

"You sure you really want to visit them? You've stayed out of 
their lives for twenty odd years," Mark asked. He wasn't worried 
about Anne. It had been hard work overcoming her past and her 
lack of self esteem but they had stuck together thru it all and 
were now closer than ever. They had come close to splitting up 
a couple of times, but never as close as when he'd 
visited Tel-Aviv just over two years ago. Whenever she wanted 
to push herself away he had stayed by her side and just loved 
her back.

Anne thought for a few moments, "Yes I do. I promised myself 
I'd see Elizabeth just before she got married, just to make sure 
she is ok. I know she is, but I want to see her just the once. This 
time I promise I won't shoot her!"

Mark grinned. "Ok, how are you going to play this?"

Anne raised an eyebrow, "I've got it all planned out. After we've 
dumped this we'll take an inflatable and sail to their island. We'll 
tell them there's been a fire on board and we need to radio for 
help. I'm sure they'll invite us for a meal so we'll stay a while and 
then after I've seen everything's ok with them we'll leave."

Mark gave Anne a hug, "I thought you'd have it all worked out. 
That's why you wanted to dump the first batch in the Indian 
Ocean isn't it? How far is their island?"

Anne took hold of Mark's hand and have him a kiss, "You know 
that's the reason we came here! I told you it was, silly! Their 
island is about 3 hours away from here. Anyway it's almost time. 
Make sure we're all set for me one last time.

"Done," Mark said and checked the release mechanism. A few 
minutes later he said "All ready when you are."

Tears of joy formed in Anne's eyes. The last time she was here 
she had vowed to stop the rape of the oceans. Now some thirty 
years afterwards, she had succeeded. Anne walked over to the 
switch and with a determined movement of her finger 
she flipped the switch.

Underneath the boat a series of pipes opened, equalized the 
pressure, and let out the modified plankton. As soon as they 
were in the water the plankton would start to filter out pollutants 
before finally dying and floating to the top for scooping up 
afterwards. The UN had provided a flotilla of ships to do the 
clear up in a few weeks time. They would track the plankton by 
using currents and satellite imagery and so skim off the dead 
plankton, thus clearing the ocean.

Anne walked away from the switch and felt the boat rock slightly 
as the last of the plankton was released. She thought back to 
her time in exile as a mermaid. What had she said at the time? It 
came back to her a few moments later and she repeated out 
loud, "I am Scylla, daughter of Poseidon, Guardian of the 
underworld which are the oceans of this world. Mortal man listen 
to my siren song and tremble."

Mark drew alongside her and pulled her close. She had done it! 
"We'd better get underway if you want to go visiting. How do you 
feel?" he said.

Anne put her arm around Mark's muscular waist, "I feel young. 
As though the world has just been born and this is the first day 
of creation. Mark, I feel reborn, forgiven and free. Now it's time 
to bury my past, so I can have a future with you."

-- o -- o -- o --

Matthew and Kat were walking hand in hand along the beach.  
Matthew's hand was around Kat's waist and her head was 
resting on his arm.  They heard the sound of a motor launch 
heading towards them and they turned to face the sound.  A 
small inflatable boat was slowly making its way thru the swell 
and was about to dock at the jetty.  Inside the boat was a young 
woman with long blonde hair and wonderful curves.  Standing 
up, steering the boat was a tall man with dark hair.  By the looks 
of them they'd been at sea for a while.

Matthew called out a greeting to them and the man waved back.  
Kat had already started to run to the jetty to investigate.  By the 
time Matthew had reached the boat it was already tied up and 
the man was helping the young woman from the boat.

"I'm so glad that you're in. Could you please help us?" Anne 
said.  Anne was relieved that both Kat and Matthew seemed to 
be doing just fine after the trauma they had gone thru two years 
ago.

"What's the problem?" Matthew said.

Anne studied Matthew's face. It still had that boyish look of 
innocence about it. He'd never lost that look, even after so much 
pain and hardship Anne thought. She recovered herself and 
quickly replied, "Sorry.  Introductions first.  My name is Dr Anne 
Baxter. This is my fiancée Mark.  We're marine biologists 
researching the effect of man's pollution on the reefs around 
here.  We suffered a fire aboard our ship that knocked out all 
our radios and damaged the rudder.  Can we use your radio to 
summon help?"

"Sure.  Does anyone need any medical help? We've a doctor 
here at the moment I'm sure she'd like to help," Kat asked.

Of course! Anne remembered Elizabeth has passed her MD at 
an even higher grade than she had. 'Bitch!' she thought to 
herself, but inside she was very proud.  

"No the rest of the crew is fine.  The ship is about ten miles out 
from here so we took the dinghy.  Besides, I used to want to be 
a medical doctor, did all the training and everything but the 
ocean holds a greater calling." Anne answered. She was 
relieved. Elizabeth was here and she would get to meet her!

"You look famished.  Why don't you come inside? It's our 
daughter Elizabeth's wedding in a couple of days so you'll 
excuse us if we're a little busy."

"Hey I recognize you now, from the TV.  You were at President 
Jameson's swearing in.  Now I know who you are.  Aren't you 
Matthew and Jane Stephens? " Mark said.

"Yeah.  We try and keep a low profile nowadays.  If you've got 
time why don't you stay for some dinner? I'm sure Elizabeth and 
John won't mind."

Anne gave Mark a nod and then said "Yeah love to.  Just let us 
call for help first."

"Agreed.  Matthew'll show Mark to the radio.  You can walk with 
me?" Kat suggested.

"Thanks.  Say, for a woman of fifty something you look very 
good. Sure hope I look as good when I'm fifty," Anne said. It felt 
strange, walking back to the house at her ease, with a woman 
she had caused so much suffering to, with whom in fact she 
shared their daughter, and as someone other than Dr Elizabeth 
Bexley. But now Dr Elizabeth Bexley was living on borrowed 
time. After this trip she would be gone and only Dr Elizabeth 
'Anne' Baxter would remain.

She thought to herself, I look better than you do and I am fifty 
She had to hold down a smile at that thought.
 

"I had some outside help.  Say, you and Mark look well suited.  
How'd you meet?"

"We met at college.  His car had broken down on the campus, I 
was driving past and I helped him fix it.  We just seemed to hit it 
off right away.  He's my soul mate.  I guess you know all about 
that?" Anne said. Her journey to meet her soul mate, Mark had 
been longer than Kat's but now she was with him it had been 
worth every minute. It pleased her to see Kat still as much in 
love with Matthew as she'd ever been.

Kat smiled.  "You bet."

-- o -- o -- o --

"The Radio's just thru there," Matthew pointed to an old looking 
radio set that was perched on a nearby table.  
  

"Thanks.  I'll only be a few minutes."

"Fine, want me to show you how to use it?"

"Nah, I can still use these old silicon units.  She's quite a woman 
isn't she?"

"Who, Kat?"

"Yeah.  She reminds me of my Elizabeth Anne.  She doesn't use 
her first name much, in case you were wondering, but I like it.  
And I love her! Anyway, If she hadn't have been there to help 
me fix my car I'd have missed my exam and failed my doctorate.  
She's irreplaceable!," that's an understatement, Mark thought. 
Both of them owed everything they held dear to Anne's 
ingenuity and courage. 

Matthew smiled "It wasn't snowing, was it?"

"Umm no.  Oh yes, I get it.  I've read about you and that Dr. 
Bexley.   We did about you in school, you know! No it wasn't.  I'd 
better make the call," If only Matthew knew what was really 
going on, Mark thought. 

"Fine, I've got dinner to get ready.  The dining room's down the 
corridor and third door on the left," Matthew said, and left the 
room.

Several minutes later Mark joined Matthew, Dr Baxter, and Kat 
in the dining room. The fake call to the coastguard had been 
made.

"Hi hun, I've just got off the radio.  They say they've sent a ship 
from Male to tow our ship back to port for repairs.  It should get 
there in a few hours," Mark said.

"Great.  Come down and sit next to me," Anne said, and 
patted the seat next to her.

"Ah, young love," a nightingale voice said from behind them.

"Dr Baxter, Mark, I'd like you to meet our daughter, Dr Elizabeth 
Stephens.  Soon to be Dr Elizabeth Richards," Kat said.

"As if I could forget.  All I've been doing for the past month is 
getting ready for my wedding.  Anyway, nice to meet you.  
Heard you had some trouble with your boat," Elizabeth said.

"Yeah all sorted now," Mark said, staring at the tall auburn haired 
woman with the blue-gray eyes. Anne had told him so much 
about her. He thought she looked cute, not a patch on Anne of 
course. Anne had spoken about her daughter with so much 
pride and love. Now that he saw her he knew that she wasn't 
wrong. 

Dr Elizabeth Stephens sat down beside Matthew.  "Hey dad, 
where's that pesky brother of mine? He's always late for dinner."

"Probably still working on his thesis.  Go and get him would you 
dear?" Kat said to Elizabeth.

"Sure mom," Elizabeth replied and got up and walked out.

"Smart girl and beautiful too.  You must be very proud," Anne's 
heart leapt. Elizabeth was fine, more than fine. She looked 
radiant and so much better than the last time they had met. 
There were no signs, physical or emotional of her brush with 
Deianeria or death. That thought pleased Anne a great deal and 
she felt another burden lift from her. It was another step in her 
healing process. She had of course seen Elizabeth in various 
magazines but seeing her alive and so much in love warmed her 
heart. It was all she could do not to run up to her and give her a 
hug. 

"We are.  We're proud of both of them.  Elizabeth beat the class 
record at Harvard set by the late Dr Bexley by a fraction of a 
point and John is looking set to graduate with honors at Yale.  
All in all we're very happy."

"Changing the subject, I hear they've nearly decontaminated 
Cairo.  It should be habitable within the next five years or so.  
Shame about the pyramids and Sphinx.  I always wanted to see 
them.  They must have been impressive," Mark said. He wanted 
to change the subject quickly. Anne was playing a dangerous 
game.

"I guess.  We only saw them in a blur on our honeymoon.  We 
had other things on our mind at the time.  But that was a LONG 
time ago.  Too long," Matthew commented.

"Almost a lifetime," Anne said softly. Again she fought down her 
emotions. These people belonged to the past. Her future was 
now with Mark. She had been right to come and say goodbye, 
this wasn't just goodbye to a few old friends, it was the burial of 
her past history. She had moved on from it, and it gave her a lot 
of pleasure to see that they had too! 

A tall man with black hair and dark brown eyes walked in "Hi 
Dad, what's for dinner?"

"Mark, Dr Baxter I'd like you to meet our son, John," Matthew 
said.

"Pleased to meet you," Mark said and held out his hand.

Shaking it John said, "Pleasure."

"Say, I'd like to write a congratulations note to Elizabeth and her 
future husband," Anne asked Anne thought. Time for me to see 
whether Kat is as sharp as she used to be. I need to say 
goodbye properly without giving myself away to the rest of them.

"Sure.  I'll go get some paper," Matthew said and went to a 
nearby drawer, rummaged around for a bit and came back with 
a notepad and pen.

Taking the pad and pen Anne thought for a while and then wrote 
on the pad.  "I'll keep this until after dinner," she said. 

Elizabeth soon joined them and sat down at her place next to 
Matthew.

After dinner Mark and Anne bade their farewells.  Anne 
handed the note to Kat and then walked off with Mark to their 
waiting boat.  

"What's the note say?" Matthew asked.

Kat scanned it and read out,

        'Wishing my sister bride all the best in her upcoming 
        marriage.  May it be fruitful and give you all your hearts 
        desire.  You are very fortunate to have parents who love 
        you and each other as much as they do.  

		Dr Anne Baxter (Scylla) and Dr Mark Andrews.'

Kat thought for a moment and said "Nice of them to do that.  Oh 
rats, they forgot something.  Don't worry I'll go."

Kat rushed out of the door and just heard Matthew call "Hey, 
you forgot what they forgot!" Ignoring Matthew's call, Kat 
sprinted down the steps to the jetty and just made it in time to 
see Anne get into the boat.

"Dr Baxter, wait!" Kat called out.

"What's up?" Dr Baxter called out. She hasn't lost her touch, 
Anne thought. She calmed herself. It wasn't everyday you said 
goodbye to thirty years of past history. She felt a little sad, but 
she knew from seeing them all again that they had emerged 
from the horror of Elizabeth's kidnap stronger than ever before. 

"You left something behind.  A wedding present from Matthew 
and me."

"Hey thanks," Anne said, got out of the boat and walked towards 
Kat. Anne smiled to herself. 

"Hi witch, a little bit different from when we last met on this jetty 
isn't it?" Kat said.

"Pardon?" Anne said, a surprised look on her face. 'Witch' was 
Kat's pet name for her so many years ago. Kat using it was the 
final proof that Kat knew. Now the question was what would she 
do with that knowledge. Anne decided to play coy. It was for the 
best.

Kat decided to lay her hunch on the table, "Come on Liz.  I've no 
idea how you pulled it off but you can drop the pretence.  It'll be 
our secret."

"Sorry Jane.  Dr Bexley's been dead for over twenty years.  
She's not a part of your life anymore.  I suggest you let me get 
back to Mark and my crew.  It's been a pleasure meeting you."

"Then why all the hints? The Scylla thing? That was the alias 
you gave yourself when you were exiled to the ocean as a 
mermaid.  What about you wanting to be a MD and then 
changing your mind? If you still had a changeling organ you 
could make yourself younger.  The deal you did with the 
government could've given you a new life and faked the 
suicide.   What about the sister thing on Elizabeth's note?"

"Jane, Dr Bexley is dead and buried.  I suggest you leave her 
there.  The rest of the world has so why can't you? Missing your 
Moriarty huh?"

Kat nodded.  Was this woman standing before her really her 
arch nemesis, Dr Elizabeth Bexley? Kat had to admit she wasn't 
sure anymore, "I guess so.  I knew the way she operated better 
than most, makes me a little paranoid sometimes."

"I understand.  She still haunts you both doesn't she?"

"In a way.  Part of us believes that she's faked all this and that 
she's alive somewhere making a new life for herself."

"What if she is? Would she want your interference? Would you 
want hers?"

"I guess not," Kat admitted.

"Then leave her in her grave and look forward to the years you 
have ahead of you."

"You're right of course.  Say, do you want to come back in a few 
days and be at Elizabeth's wedding."

Anne thought for a moment. She would have loved to come but 
she didn't trust herself to stay quiet and anonymous. She had 
seen all she had wanted to see. Elizabeth was now as happy as 
she was, and that was all that mattered to her. Matthew and Kat 
were as in love as ever and all was as it should be. She herself 
had so much yet to do and so much she wanted to do. 

She looked at Kat's deep brown eyes and said, "No thanks, I've 
grown out of being the uninvited guest.  Thanks for the offer 
though, but I need to get our ship repaired and operational 
again.  Hope I can drop in occasionally?" She had no intention 
of coming back. This was the goodbye she had wanted to say 
for so long.

"Anytime," Kat said softly.

Anne turned to go and walked towards the waiting dinghy.

"Oh Dr Baxter?" Kat called out.

Anne turned around "Yeah?"

"Thank you," Kat said. 

"My pleasure.  See ya later Kitty Kat," Anne said and gave a 
single fingered wave. She then paused for a moment. "You're 
having a good life, I can see that.  All of the others too who were 
involved in that Fury business way back?" Kat saying thank you 
to her meant so much that she could hardly speak.

Kat nodded slowly, wondering why she was asking.

'How much do they really know' Anne thought and decided to 
ask the question, "Ever wonder if Dr Bexley was being straight 
with you? Y'know about not being able to turn you back as you 
were? Even your daughter, Elizabeth looks a lot like her." 

"Sometimes I wonder, but that's all in the past now. As you say, 
life is good to us. As for Elizabeth, we realized while she was 
growing up that she was a direct clone of Dr Bexley.  She's 
much too clever and wilful, to be anything or anyone else.  And 
yes, she does look just like her, even though she wears her hair 
softer. We were as angry as hell when we found out, but in the 
end we realized we loved her anyway. You love people for who 
they are, not where they came from, or who they may become."

Anne gave a smile, "As it should be," Kat always had a way of 
summing things up. Feelings that had taken her years to come 
to terms with Kat had touched on in those last few words. Anne 
would miss her. 

Kat turned and walked away, deep in thought.  Maybe she was 
right after all, who knew? Dr Baxter certainly wasn't saying.  She 
turned to watch Dr Baxter getting back into the dinghy.

"All the best 'hell bitch' and I hope it works for you this time," she 
whispered to herself.

She then turned back to walk to the house.  Besides, Cathline 
and family would be arriving tomorrow afternoon.  And there 
was a wedding to finalize.  

As she reached the top of the steps leading to the house she 
turned once more to see the sun setting beneath the horizon.  
Looking down she saw the dinghy disappearing into the 
distance.  She smiled to herself and went inside.

-- o -- o -- o --

Seventy five years later
-------------------------------

"Great Grandmother come HERE!" a small juvenile voice 
insisted, and a young girl tugged at an old lady's long flowing 
skirt.

"Not just yet child. I'll be with you soon," the old woman 
promised.

"But I'm BORED!" the girl protested.

"Hush now. Great Grandma's needs to do this, before..," the old 
woman's voice tailed off.

Knowing that when great grandma said she needed to do 
something nothing could distract her from it, the child 
scampered off to chase butterflies in the nearby flowerbeds.

The old woman straightened herself up and looked over the 
expanse of graves that panned out in front of her. A tear formed 
in her eye. Too many people and too many lives wasted. Her 
focus shifted down to the two large, marble headstones that 
were in front of her. She read them once again

        "Matthew Stephens               Jane 'Kat' Stephens 

         1969-2067                       1972-2073

                True love knows no boundaries."

She had had so much to say to them; so much she wanted to 
tell them, but now even thirty years after their deaths she didn't 
know what to say. They'd never known of the wonderful life 
she'd had with Mark, of the two children she'd borne him, 
nor that she was a great, great grandmother to three more. 
She hoped, no she knew they'd be happy for her and that, in 
the end was all that mattered.

She turned her head to briefly check if Cathline Jane was still 
ok, and saw that she was. She was using a twig to try and dig 
out a worm that had had the temerity to escape her clutches. 
She saw Cathline Jane look at her hand and concentrate. Within
a few seconds it had reformed into a scoop, perfect for digging
out worms with. She sighed, she'd told Cathline Jane hundreds
of times not to play around with her 'gift', but as usual it
had gone in one ear and out the other. Still, Cathline Jane 
would learn soon enough, just as her own children had.

In the corner of her eye she saw another figure walking towards 
her.  Her eyes took a moment to register, but as soon as she 
saw the graying auburn hair and the tall but still slender frame 
she knew who it was. The figure noticed her and speeded up in 
order to reach her.

"Hello Mother," the figure said.

The old woman was staggered! How did she know!

"I know what you are thinking. I should do. I've thought like you 
for the past one hundred years. I know what today is and I know 
that only one person would be here at my parents graveside 
today. Only one person would never miss this day. That person 
is you."

"Pray tell, what day do you think it is?" the old woman asked.

"It's hundred years since you placed me inside Kat isn't it? "

"A hundred years eh? That's a long time, a very long time.." The 
old woman's voice trailed away, as if drifting into past memories.
The old woman continued. "Do I look over a hundred and thirty 
years old?

"Don't deny it mother. I know it's you!"

"If you say so. Tell me why did you come here? Was it to meet 
me?"

"You know it was, and that was also why you came too.  I 
wanted to say thank you."

"Thank you for what?"

"For giving me the chance to live. Without you I would not be 
here. It took me years to work out how I was cured, but 
eventually I did it. 'Cold boot' huh. Primitive nowadays but 
effective all the same. Thanks to you I would have never known 
the love of a good man and the joy of having children of my 
own."

"It's not me you should be thanking, it's them," the old woman 
nodded towards the gravestones.

"One thing they never realized was that without you there would 
be no them."

"True love will always find a way. I once believed that all love 
was unrequited, but I now see that was a mistake. I have known 
what it is to love and to be loved, and as I near the end of my 
life I see that as my greatest achievement. Forget about saving 
oceans. That was nothing compared to what Mark and I shared 
for so many years. I am so proud of you. I watched you grow up, 
have your own children, and then become a grandmother yourself. 
There wasn't a day that went past when I didn't thank God for 
you, or pray for your happiness," the old woman's voice tailed 
off, lost in a myriad of memories.

"It was you who came to visit us, just before my wedding wasn't 
it? Of course you were Dr Anne Baxter then but I knew. Kat did 
too. She never said anything to anybody but looking back on it I 
see now that she knew it was you. You came to say goodbye 
didn't you?"

The old woman's face dropped and a certain sparkle slowly 
faded from her eyes, "Listen. I have so little time left. I can feel 
my body slowly breaking down almost by the day. I'm paying the 
price for stopping the Guild in the way I did so many years ago. 
Cathline-Jane over there doesn't know it but soon Great Great 
Grandma Elizabeth Anne will be gone and that will be that. I 
want to spend the few weeks remaining to me with my family. 
Tell me what are your intentions?"

"I want to be there. I want to be there at the end. I know Mom 
and Dad would want to be there if they could."

The old woman gave a smile, leant in towards the figure and 
whispered in her ear. The lady nodded in agreement and 
whispered back "I promise."
  

-- o -- o -- o --

Three weeks later
------------------------

"I'm not too late am I?" the woman said breathlessly.

A nurse, looking tired and fatigued as though she had been 
waiting up all night shook her head, "She stopped me from 
going, she forbade me to leave until you came."

"How is she?"

"I'm amazed she's hung on this long. I'll say one thing for her, 
she's a survivor. I wanted to give her some help by putting her 
on bio-support, but she refused. You'd better go in, there's not 
much time." The nurse gestured for the woman to follow her.

"I knew you'd come," the woman in the bed rasped. She was a 
pale imitation of the woman at the graveside a few weeks a go. 
Her hair had thinned and her skin was a gray deathly pallor. 
Some other people who Elizabeth assumed was her family 
stood around the bed. An elderly woman looked at Elizabeth 
and mouthed "Sister," by her side was an older looking man. He 
turned to Elizabeth, smiled and mouthed, "Brother."

Elizabeth held the old lady's hand to her lips and kissed it, 
"Goodbye mother" she whispered softly. The old woman smiled 
back and Elizabeth felt the hand go limp, and then realizing 
what had happened started to sob softly. Her younger brother 
and sister moved in to comfort each other and the first moment 
of emotion they had ever shared was that of grief.

After one hundred and forty years of life Dr Elizabeth Anne 
Bexley was gone. 

Elizabeth lovingly rested Dr Bexley's hand back on her body and 
turned to leave. She took one look back at her peaceful face 
and gave a smile, this time there would be no faked suicides, 
visits for a wedding or narrow escapes. She thought of the little 
girl playing in the graveyard, of the memories of her own family 
growing, playing and finally leaving to lead their own lives. Her 
mother had been right. It had been worth it, even in the times of 
pain and struggle true love knows no limitations or barriers. It 
always prevails and knows no boundaries.

-- o -- o -- o -- 

Two weeks later.
-----------------------

Elizabeth stood by the quayside and watched Dr Bexley's family 
carry a lit torch to a large wooden boat. Her body had been 
loaded up onto the deck of the boat and wrapped down onto an 
ornate table. Flowers from all over world littered the deck, 
forming a floral carpet that seemed to shine with every color 
imaginable. A band and choir stood ready; as Dr Bexley's son 
and daughter, Elizabeth's brother and sister walked towards the 
boat each carrying a wooden road wrapping in cloth. The man 
took out a small lighter and lit the torch. He waited for a few 
moments before throwing the burning torch onto the deck. The 
woman passed her torch to him and he lit it for her and passed it 
back again. She threw it with all her might and it landed on the 
stern of the boat.  As they slowly started to walk away the band 
started to play one of Dr Bexley's favorite hymns. 

        "Before the throne of God above
        I have a strong and perfect plea
        A great high priest who's name is love
        Who ever lives and pleads for me
        My name is graven on his hands
        My name is written on his heart
        I know that while in heaven he stands
        No tongue can bid me thence depart
        No tongue can bid me thence depart"

She felt a squeeze on her hand as Alex sought to give her 
comfort. Over the years Alex had been a source of strength, 
comfort and love. He'd been an ideal father to her two children, 
and now just having him there, holding her hand made her feel 
safe and secure. She closed her eyes and listened to the choir 
sing the refrain.  

        "My name is graven on his hands
        My name is written on his heart
        I know that while in heaven he stands
        No tongue can bid me thence depart
        No tongue can bid me thence depart"

The burning boat was gently pushed away from the quayside 
using large wooden poles. Underneath the boat small electric 
motors ensured the boat wouldn't float back into shore and so 
the boat gradually powered it's self away. Elizabeth saw the 
flames start to lick up the mast and around the table. Smoke 
began to billow out as the fire caught hold.

        "When Satan tempts me to despair,
        And tells me of the guilt within,
        Upward I look and see him there
        Who made an end to all my sin
        Because the sinless savior died
        My sinful soul is counted free;
        For God the just is satisfied
        To look on him and pardon me
        To look on him and pardon me"

The fire had really taken hold, and now the flames masked the 
table and nearly the whole deck of the boat. Smoke now 
consumed the sky surrounding the boat. It surely wouldn't be 
too long before the whole deck was burned thru. 

        "Behold him there! The risen Lamb
        My perfect spotless righteousness
        The great unchangeable I AM
        The king of glory and of grace!
        One with himself I cannot die
        My soul is purchased with his blood
        My life is hid with Christ on high
        With Christ, my savior and my God
        With Christ, my savior and my God"

The boat was now almost all in flames and Elizabeth knew it 
was only a matter of time before the fire burnt it's way into the 
hold of the boat and it started to sink. By that time the small boat 
would be far out to sea, taking with it the body of an exceptional 
woman, her namesake, her soul mate and her mother. It was so 
fitting that her final resting place would be the ocean which she 
had done so much to save. She closed her eyes and listened to 
the last refrain of the hymn. 

        "One with himself I cannot die
        My soul is purchased with his blood
        My life is hid with Christ on high
        With Christ, my savior and my God
        With Christ, my savior and my God"

Deep down she knew she would see Dr Bexley again and the 
words of the hymn filled her with hope. The words reminded her 
that there was always hope, always love and always 
forgiveness, even for people like her. It was, she decided, as 
good a lesson to learn as any. Kat, Cathline, and Matthew would 
have been proud of her. Elizabeth gave Alex's hand another 
squeeze and snuggled close to him. She felt him draw her 
closer and together they watched as the boat, still burning 
fiercely, drifted off into the distance.

  
   ~Soul Mates~	    © 1994-2002 by Darkside
	Illustrations © by Original Artists

	All Rights Reserved. These documents (including, without
  limitation, all articles, text, images, logos, compilation design) may printed for
  personal use only. No portion of these documents may be stored electronically, distributed
  electronically, or otherwise made available without express written consent of the
  copyright holder. 











  

Back to Darkside's
Story Page...










  
Click Right Mouse Button Anywhere On Page For Site Menu...


SCRIPT FREE SITE MENUHomeWhat's New Today?My Own ThoughtsTG Fiction LibraryBuffy Fan FictionAlternate UniversesDownloadable TEXT StoriesMy Favorite Games, Fanvids, Music, Etc.Favorite LinksAppreciation For Your SupportDisclaimers, Warnings, And Legal StuffEmail Beverly